Incidental Mutation 'R7903:Krt34'
ID 610102
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission 045955-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7903 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 99932321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect probably null
Transcript: ENSMUST00000056362
AA Change: M1K

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,608,783 (GRCm39) probably null Het
Acsm2 A T 7: 119,195,215 (GRCm39) T596S probably benign Het
Aggf1 T C 13: 95,492,966 (GRCm39) K548E probably damaging Het
Anapc15 T G 7: 101,547,193 (GRCm39) V23G probably benign Het
Atp10a T C 7: 58,308,570 (GRCm39) L123P probably damaging Het
Brf2 G A 8: 27,616,121 (GRCm39) T88M possibly damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc14 A T 16: 34,525,280 (GRCm39) H191L probably damaging Het
Cdc42bpg T A 19: 6,363,499 (GRCm39) V453E possibly damaging Het
Corin T C 5: 72,458,843 (GRCm39) K1110E probably benign Het
Cubn T C 2: 13,473,680 (GRCm39) D421G probably damaging Het
D130043K22Rik T G 13: 25,059,995 (GRCm39) V622G probably damaging Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Dnah3 A G 7: 119,641,351 (GRCm39) S1190P probably damaging Het
Eif4a3l2 A G 6: 116,528,212 (GRCm39) T30A probably benign Het
Elavl1 T C 8: 4,351,756 (GRCm39) K120R probably benign Het
Epb41l3 T A 17: 69,581,332 (GRCm39) probably null Het
Fubp1 G A 3: 151,920,498 (GRCm39) W79* probably null Het
Gsto2 T A 19: 47,873,096 (GRCm39) I157N possibly damaging Het
Gucy2d A G 7: 98,108,272 (GRCm39) D735G probably damaging Het
H2-D1 A T 17: 35,482,967 (GRCm39) I166F probably damaging Het
Hars2 C A 18: 36,919,245 (GRCm39) R128S probably damaging Het
Igf1r T C 7: 67,834,500 (GRCm39) F496S probably damaging Het
Inf2 T C 12: 112,578,988 (GRCm39) V1256A unknown Het
Kif19b T C 5: 140,461,767 (GRCm39) V523A probably damaging Het
Lamtor2 T C 3: 88,459,817 (GRCm39) N26D possibly damaging Het
Map3k10 T C 7: 27,357,382 (GRCm39) T799A probably damaging Het
Map3k8 T C 18: 4,349,162 (GRCm39) D52G probably benign Het
Mcm10 T C 2: 5,000,613 (GRCm39) T693A probably benign Het
Mgarp G T 3: 51,304,119 (GRCm39) A10E Het
Mns1 A T 9: 72,360,093 (GRCm39) E414D probably benign Het
Myo16 A G 8: 10,426,265 (GRCm39) S341G probably null Het
Nags A T 11: 102,037,503 (GRCm39) D198V possibly damaging Het
Nedd4l C T 18: 65,319,438 (GRCm39) P464S probably damaging Het
Nicol1 T A 5: 34,140,910 (GRCm39) probably null Het
Nsfl1c T C 2: 151,338,522 (GRCm39) Y42H probably damaging Het
Obscn T C 11: 58,969,942 (GRCm39) M67V probably benign Het
Or2b28 T A 13: 21,532,046 (GRCm39) I316K probably benign Het
Pcsk5 A T 19: 17,549,847 (GRCm39) L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Pfkfb4 A T 9: 108,828,019 (GRCm39) N64Y probably damaging Het
Pidd1 A G 7: 141,019,744 (GRCm39) F673L probably damaging Het
Pla2g7 A G 17: 43,911,512 (GRCm39) probably null Het
Pml T C 9: 58,156,867 (GRCm39) E36G probably benign Het
Proser1 C A 3: 53,386,503 (GRCm39) S795* probably null Het
Ptprs T A 17: 56,731,960 (GRCm39) K1016* probably null Het
Rbfox1 T A 16: 7,042,375 (GRCm39) S76R probably benign Het
Reck A T 4: 43,927,166 (GRCm39) I486F possibly damaging Het
Rnf103 A T 6: 71,486,138 (GRCm39) K256N probably damaging Het
Setd2 A T 9: 110,446,905 (GRCm39) N713I Het
Slc38a4 C T 15: 96,906,809 (GRCm39) G310S probably benign Het
Slc7a4 C T 16: 17,393,145 (GRCm39) R218H probably benign Het
Slc7a7 T C 14: 54,611,366 (GRCm39) H344R probably damaging Het
Smarcc1 G A 9: 110,033,334 (GRCm39) E810K probably benign Het
Sord T A 2: 122,093,706 (GRCm39) M275K probably benign Het
Spire2 C A 8: 124,095,489 (GRCm39) P631T probably benign Het
Sult6b1 T C 17: 79,198,279 (GRCm39) K207R probably benign Het
Syde2 T A 3: 145,704,543 (GRCm39) D498E probably damaging Het
Syne2 C T 12: 76,110,958 (GRCm39) T1024M probably damaging Het
Tdrd9 T A 12: 112,018,410 (GRCm39) D1276E possibly damaging Het
Tm7sf2 A G 19: 6,121,365 (GRCm39) F219S probably damaging Het
Tmcc2 C T 1: 132,288,199 (GRCm39) G496D probably benign Het
Tmtc4 G A 14: 123,165,060 (GRCm39) H600Y probably benign Het
Vmn1r224 A T 17: 20,640,309 (GRCm39) L295F probably benign Het
Vmn1r91 T C 7: 19,835,135 (GRCm39) I18T possibly damaging Het
Vwa7 G A 17: 35,236,763 (GRCm39) R110H probably damaging Het
Wbp2nl C T 15: 82,190,332 (GRCm39) Q87* probably null Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1714:Krt34 UTSW 11 99,930,953 (GRCm39) missense possibly damaging 0.95
R1879:Krt34 UTSW 11 99,929,118 (GRCm39) missense possibly damaging 0.76
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R3876:Krt34 UTSW 11 99,931,791 (GRCm39) missense probably benign 0.02
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
R9514:Krt34 UTSW 11 99,929,226 (GRCm39) missense probably damaging 1.00
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCATTGCCATTGAAGGAGC -3'
(R):5'- GCTGTGACACAAGCCAAATG -3'

Sequencing Primer
(F):5'- TGCCATTGAAGGAGCCCTCAC -3'
(R):5'- CTCTTTGAAAGCAATCTAAGGAGCG -3'
Posted On 2019-12-20