Incidental Mutation 'R7903:Nags'
ID 610103
Institutional Source Beutler Lab
Gene Symbol Nags
Ensembl Gene ENSMUSG00000048217
Gene Name N-acetylglutamate synthase
Synonyms 1700120E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock # R7903 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102145513-102149477 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102146677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 198 (D198V)
Ref Sequence ENSEMBL: ENSMUSP00000050258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055409]
AlphaFold Q8R4H7
Predicted Effect possibly damaging
Transcript: ENSMUST00000055409
AA Change: D198V

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050258
Gene: ENSMUSG00000048217
AA Change: D198V

DomainStartEndE-ValueType
low complexity region 9 48 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:NAT 349 514 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-acetylglutamate synthase gene encodes a mitochondrial enzyme that catalyzes the formation of N-acetylglutamate (NAG) from glutamate and acetyl coenzyme-A. NAG is a cofactor of carbamyl phosphate synthetase I (CPSI), the first enzyme of the urea cycle in mammals. This gene may regulate ureagenesis by altering NAG availability and, thereby, CPSI activity. Deficiencies in N-acetylglutamate synthase have been associated with hyperammonemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: In the absence of N-carbamyl-L-glutamate and L-citrulline supplementation homozygous null mice develop severe hyperammonemia and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Epb41l3 T A 17: 69,274,337 probably null Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm1673 T A 5: 33,983,566 probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Nags
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Nags APN 11 102149066 missense probably damaging 1.00
IGL02308:Nags APN 11 102149071 makesense probably null
IGL02551:Nags APN 11 102147941 missense probably damaging 1.00
IGL03114:Nags APN 11 102148988 missense probably damaging 1.00
R0254:Nags UTSW 11 102147945 missense probably damaging 1.00
R0395:Nags UTSW 11 102145704 missense unknown
R0573:Nags UTSW 11 102146979 missense probably damaging 0.97
R3085:Nags UTSW 11 102145984 missense probably damaging 1.00
R4687:Nags UTSW 11 102148196 missense probably damaging 0.97
R4852:Nags UTSW 11 102146621 nonsense probably null
R5093:Nags UTSW 11 102146569 missense probably damaging 1.00
R5516:Nags UTSW 11 102145947 nonsense probably null
R6374:Nags UTSW 11 102146511 missense possibly damaging 0.58
R6713:Nags UTSW 11 102146521 missense probably benign 0.27
R6741:Nags UTSW 11 102146892 missense possibly damaging 0.88
R7082:Nags UTSW 11 102147472 missense possibly damaging 0.90
R8234:Nags UTSW 11 102148998 missense probably damaging 1.00
R9072:Nags UTSW 11 102147521 missense probably damaging 1.00
R9073:Nags UTSW 11 102147521 missense probably damaging 1.00
R9090:Nags UTSW 11 102146758 missense probably benign 0.25
R9271:Nags UTSW 11 102146758 missense probably benign 0.25
R9546:Nags UTSW 11 102148255 missense probably damaging 0.97
X0017:Nags UTSW 11 102145747 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTGTACAGGTCGATGAGGAGG -3'
(R):5'- TGCAACAGGTCTGTCTCCAC -3'

Sequencing Primer
(F):5'- TACAGGTCGATGAGGAGGTGATC -3'
(R):5'- ACGATGCCACCGTAGCTGTG -3'
Posted On 2019-12-20