Incidental Mutation 'R7903:Nedd4l'
ID610125
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R7903 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65186367 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 464 (P464S)
Ref Sequence ENSEMBL: ENSMUSP00000079280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: P464S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: P464S

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: P585S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: P585S

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
AA Change: P444S

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: P464S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Epb41l3 T A 17: 69,274,337 probably null Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm1673 T A 5: 33,983,566 probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense probably benign
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTTACCAGGTTGCTCAC -3'
(R):5'- CTGTACCCCATCTGGAAAGCTC -3'

Sequencing Primer
(F):5'- GGTTGCTCACCCCAAACTG -3'
(R):5'- CCATCTGGAAAGCTCACTGAGG -3'
Posted On2019-12-20