Incidental Mutation 'R7904:Fam171b'
ID 610136
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Name family with sequence similarity 171, member B
Synonyms D430039N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7904 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 83812636-83883486 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83853505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 122 (I122T)
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051454
AA Change: I122T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388
AA Change: I122T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,792,003 probably null Het
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Dbnl T A 11: 5,791,779 probably null Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnah6 G A 6: 73,135,467 probably null Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Itga9 G T 9: 118,877,226 probably null Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wfdc1 A G 8: 119,680,031 probably null Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83876728 nonsense probably null
IGL01309:Fam171b APN 2 83879447 nonsense probably null
IGL01515:Fam171b APN 2 83880233 missense probably damaging 0.99
IGL01604:Fam171b APN 2 83879600 missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83855537 splice site probably benign
IGL01784:Fam171b APN 2 83879687 missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83853439 missense probably damaging 1.00
R1203:Fam171b UTSW 2 83812969 missense probably benign 0.05
R1530:Fam171b UTSW 2 83880189 missense probably damaging 1.00
R1539:Fam171b UTSW 2 83880098 missense probably benign 0.00
R1564:Fam171b UTSW 2 83880284 missense probably damaging 1.00
R1858:Fam171b UTSW 2 83853381 missense probably benign
R1940:Fam171b UTSW 2 83812874 small deletion probably benign
R2131:Fam171b UTSW 2 83879858 missense probably damaging 0.97
R3746:Fam171b UTSW 2 83879600 missense probably damaging 1.00
R3777:Fam171b UTSW 2 83878261 missense probably benign 0.03
R3840:Fam171b UTSW 2 83880062 missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83880359 missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83855509 nonsense probably null
R5178:Fam171b UTSW 2 83879987 missense probably damaging 1.00
R5282:Fam171b UTSW 2 83853605 critical splice donor site probably null
R5544:Fam171b UTSW 2 83855527 missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83812873 missense probably damaging 0.99
R5786:Fam171b UTSW 2 83878236 missense probably benign 0.38
R6190:Fam171b UTSW 2 83876698 missense probably benign
R6247:Fam171b UTSW 2 83879208 missense probably damaging 1.00
R6309:Fam171b UTSW 2 83860460 missense probably damaging 0.99
R6324:Fam171b UTSW 2 83879264 nonsense probably null
R7127:Fam171b UTSW 2 83879766 missense probably benign 0.25
R7201:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7223:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7689:Fam171b UTSW 2 83879388 missense probably benign 0.38
R8069:Fam171b UTSW 2 83812874 small deletion probably benign
R8236:Fam171b UTSW 2 83880206 missense probably damaging 0.97
R8252:Fam171b UTSW 2 83878242 missense probably benign 0.00
R8458:Fam171b UTSW 2 83860520 missense probably benign 0.21
R8463:Fam171b UTSW 2 83853457 missense probably damaging 1.00
R8546:Fam171b UTSW 2 83855451 missense probably damaging 1.00
R8706:Fam171b UTSW 2 83860520 missense probably benign 0.21
R8792:Fam171b UTSW 2 83812759 missense probably damaging 1.00
R9187:Fam171b UTSW 2 83880021 missense probably damaging 1.00
R9225:Fam171b UTSW 2 83880042 missense probably damaging 1.00
R9266:Fam171b UTSW 2 83853582 missense probably damaging 1.00
R9353:Fam171b UTSW 2 83876684 missense probably benign 0.13
R9532:Fam171b UTSW 2 83879868 missense probably damaging 1.00
R9549:Fam171b UTSW 2 83812855 missense probably damaging 0.99
R9621:Fam171b UTSW 2 83812765 missense probably damaging 1.00
R9625:Fam171b UTSW 2 83853570 missense probably damaging 1.00
R9784:Fam171b UTSW 2 83860443 missense probably damaging 0.99
RF001:Fam171b UTSW 2 83812886 small insertion probably benign
RF009:Fam171b UTSW 2 83812880 small insertion probably benign
RF011:Fam171b UTSW 2 83812873 small insertion probably benign
RF011:Fam171b UTSW 2 83812895 small insertion probably benign
RF013:Fam171b UTSW 2 83812895 small insertion probably benign
RF027:Fam171b UTSW 2 83812876 small insertion probably benign
RF029:Fam171b UTSW 2 83812892 small insertion probably benign
RF036:Fam171b UTSW 2 83812892 small insertion probably benign
RF055:Fam171b UTSW 2 83812876 small insertion probably benign
RF056:Fam171b UTSW 2 83812896 small insertion probably benign
RF060:Fam171b UTSW 2 83812877 small insertion probably benign
RF063:Fam171b UTSW 2 83812896 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTCGACCTGATTCAGTTTCTG -3'
(R):5'- TCTCAGCATAGTATATGGATTTCCC -3'

Sequencing Primer
(F):5'- ACCTGATTCAGTTTCTGTTCGTTTG -3'
(R):5'- GCATAGTATATGGATTTCCCCTAGG -3'
Posted On 2019-12-20