Incidental Mutation 'R7904:Unc13b'
ID610145
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R7904 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43217075 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 458 (D458G)
Ref Sequence ENSEMBL: ENSMUSP00000146589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207569
Predicted Effect probably benign
Transcript: ENSMUST00000207708
AA Change: D458G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,792,003 probably null Het
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Dbnl T A 11: 5,791,779 probably null Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnah6 G A 6: 73,135,467 probably null Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Itga9 G T 9: 118,877,226 probably null Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Wfdc1 A G 8: 119,680,031 probably null Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7941:Unc13b UTSW 4 43176285 missense unknown
R7950:Unc13b UTSW 4 43232573 nonsense probably null
R7980:Unc13b UTSW 4 43171860 missense unknown
R7987:Unc13b UTSW 4 43217075 missense probably benign
R8069:Unc13b UTSW 4 43177597 missense unknown
R8101:Unc13b UTSW 4 43239918 missense probably benign 0.08
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGAACATCAGGAGCATCC -3'
(R):5'- CAAAGTCTCAGGCCCTATGATC -3'

Sequencing Primer
(F):5'- TCCTGGGTAACCAGTGAT -3'
(R):5'- AAAGTCTCAGGCCCTATGATCACTTC -3'
Posted On2019-12-20