Incidental Mutation 'R7904:Clstn1'
ID 610149
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Name calsyntenin 1
Synonyms Cst-1, alcadein alpha, calsyntenin-1, 1810034E21Rik
MMRRC Submission 045956-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7904 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 149670925-149733356 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 149698594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 60 (I60N)
Ref Sequence ENSEMBL: ENSMUSP00000036962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]
AlphaFold Q9EPL2
Predicted Effect probably benign
Transcript: ENSMUST00000039144
AA Change: I60N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: I60N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105691
AA Change: I60N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: I60N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,567,591 (GRCm39) T384I probably benign Het
Astn1 T C 1: 158,424,886 (GRCm39) F691L probably benign Het
Azgp1 A G 5: 137,985,869 (GRCm39) E164G probably damaging Het
Bdp1 A G 13: 100,177,944 (GRCm39) V1975A probably benign Het
Cactin T C 10: 81,161,699 (GRCm39) Y744H possibly damaging Het
Col16a1 T A 4: 129,948,001 (GRCm39) C240* probably null Het
Col6a5 T C 9: 105,805,720 (GRCm39) D1062G unknown Het
Csmd2 T C 4: 128,313,346 (GRCm39) L1341P Het
Cyp51 A T 5: 4,150,173 (GRCm39) F183L probably damaging Het
Dbnl T A 11: 5,741,779 (GRCm39) probably null Het
Ddx60 G A 8: 62,430,924 (GRCm39) V820I possibly damaging Het
Dnaaf9 A T 2: 130,633,923 (GRCm39) probably null Het
Dnah11 T A 12: 117,867,003 (GRCm39) D4046V possibly damaging Het
Dnah6 G A 6: 73,112,450 (GRCm39) probably null Het
Dnttip1 A G 2: 164,589,472 (GRCm39) Y89C probably benign Het
Efr3a T A 15: 65,696,527 (GRCm39) V144E probably damaging Het
Epha8 T C 4: 136,659,050 (GRCm39) Q868R possibly damaging Het
Ercc5 G T 1: 44,214,998 (GRCm39) probably null Het
Fam118a A G 15: 84,929,834 (GRCm39) S21G probably damaging Het
Fam171b T C 2: 83,683,849 (GRCm39) I122T probably damaging Het
Fat4 T A 3: 38,941,690 (GRCm39) S194R probably damaging Het
Fcho2 T A 13: 98,932,871 (GRCm39) T44S possibly damaging Het
Gm21698 C A 5: 26,189,256 (GRCm39) L232F probably benign Het
Gpr149 T A 3: 62,502,356 (GRCm39) D500V probably benign Het
Gpx8 T A 13: 113,182,035 (GRCm39) T133S probably benign Het
Hdlbp A T 1: 93,351,092 (GRCm39) I542N probably damaging Het
Hid1 G A 11: 115,246,187 (GRCm39) S361F probably damaging Het
Igdcc4 C A 9: 65,041,801 (GRCm39) A1076E probably benign Het
Il4ra A G 7: 125,164,845 (GRCm39) K7E probably benign Het
Inka2 T C 3: 105,623,730 (GRCm39) C35R probably damaging Het
Itga9 G T 9: 118,706,294 (GRCm39) probably null Het
Kif5c T C 2: 49,591,095 (GRCm39) S316P probably damaging Het
Kmt5c A T 7: 4,749,158 (GRCm39) T264S probably damaging Het
Litafd A G 16: 8,501,681 (GRCm39) H61R Het
Lrrc18 A G 14: 32,731,052 (GRCm39) N197S probably benign Het
Mcoln1 C A 8: 3,558,356 (GRCm39) D203E probably benign Het
Mitf T C 6: 97,990,671 (GRCm39) V358A probably damaging Het
Mki67 A T 7: 135,294,816 (GRCm39) L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,076 (GRCm39) F255I possibly damaging Het
Muc16 T C 9: 18,566,946 (GRCm39) T1858A unknown Het
Mug1 G A 6: 121,828,424 (GRCm39) V279I probably benign Het
Or6c68 T C 10: 129,157,665 (GRCm39) Y58H probably damaging Het
Otulin G T 15: 27,630,580 (GRCm39) A39E probably benign Het
Pcdh17 A T 14: 84,685,924 (GRCm39) D797V possibly damaging Het
Pdlim5 G A 3: 142,018,154 (GRCm39) S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Ppp2r1a T G 17: 21,182,003 (GRCm39) probably null Het
Ranbp6 T C 19: 29,789,813 (GRCm39) I180V probably benign Het
Rbm27 G T 18: 42,465,921 (GRCm39) R869L probably damaging Het
Rtn4r A G 16: 17,969,349 (GRCm39) D259G probably benign Het
Ryr3 T C 2: 112,611,369 (GRCm39) E2271G probably damaging Het
Sbk1 A G 7: 125,891,208 (GRCm39) Y214C probably damaging Het
Scg3 C T 9: 75,551,149 (GRCm39) E459K probably damaging Het
Scin T G 12: 40,126,999 (GRCm39) E449D probably damaging Het
Sel1l3 T C 5: 53,297,166 (GRCm39) K760R probably benign Het
Sh3pxd2a A G 19: 47,308,753 (GRCm39) L145S possibly damaging Het
Sh3yl1 A G 12: 30,991,995 (GRCm39) D188G probably benign Het
Slc38a1 A T 15: 96,521,921 (GRCm39) L13Q possibly damaging Het
Smyd4 T C 11: 75,240,613 (GRCm39) I36T possibly damaging Het
Spata31f1a A G 4: 42,850,765 (GRCm39) S464P possibly damaging Het
Stab2 A T 10: 86,790,056 (GRCm39) L570* probably null Het
Tg G T 15: 66,577,128 (GRCm39) A1484S probably benign Het
Tm7sf2 A T 19: 6,118,942 (GRCm39) N677K probably damaging Het
Tmem235 T G 11: 117,751,717 (GRCm39) L47R probably damaging Het
Tmem87a A G 2: 120,210,198 (GRCm39) S252P probably damaging Het
Unc13b A G 4: 43,217,075 (GRCm39) D458G probably benign Het
Wfdc1 A G 8: 120,406,770 (GRCm39) probably null Het
Wnt16 A G 6: 22,297,989 (GRCm39) Y285C probably damaging Het
Wwc2 A T 8: 48,309,270 (GRCm39) N837K unknown Het
Xdh A G 17: 74,229,467 (GRCm39) F329L probably benign Het
Yaf2 G T 15: 93,183,466 (GRCm39) H115N probably benign Het
Zbtb16 G T 9: 48,744,272 (GRCm39) N13K probably damaging Het
Zfhx3 A T 8: 109,677,695 (GRCm39) D2915V probably damaging Het
Zfp236 A T 18: 82,627,507 (GRCm39) V1564E possibly damaging Het
Zfp407 G T 18: 84,579,381 (GRCm39) H577Q not run Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149,719,700 (GRCm39) missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149,722,769 (GRCm39) missense probably benign 0.05
IGL00911:Clstn1 APN 4 149,727,648 (GRCm39) splice site probably benign
IGL01394:Clstn1 APN 4 149,719,239 (GRCm39) missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149,729,809 (GRCm39) missense probably benign 0.03
IGL02406:Clstn1 APN 4 149,711,816 (GRCm39) missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149,716,299 (GRCm39) missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149,713,968 (GRCm39) missense probably null 1.00
R0012:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0064:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149,719,253 (GRCm39) missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149,728,131 (GRCm39) missense probably damaging 1.00
R0394:Clstn1 UTSW 4 149,728,635 (GRCm39) missense probably benign 0.00
R0609:Clstn1 UTSW 4 149,713,757 (GRCm39) splice site probably null
R0685:Clstn1 UTSW 4 149,731,312 (GRCm39) missense probably benign 0.24
R0724:Clstn1 UTSW 4 149,728,081 (GRCm39) missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149,731,286 (GRCm39) missense probably benign 0.21
R1470:Clstn1 UTSW 4 149,719,179 (GRCm39) missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149,719,179 (GRCm39) missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149,713,864 (GRCm39) missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149,728,183 (GRCm39) missense probably benign 0.02
R3803:Clstn1 UTSW 4 149,719,796 (GRCm39) missense probably damaging 0.99
R3836:Clstn1 UTSW 4 149,722,790 (GRCm39) missense probably damaging 1.00
R3838:Clstn1 UTSW 4 149,722,790 (GRCm39) missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149,729,486 (GRCm39) missense probably benign 0.07
R5024:Clstn1 UTSW 4 149,719,751 (GRCm39) missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149,719,703 (GRCm39) missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149,728,524 (GRCm39) missense probably benign 0.00
R6354:Clstn1 UTSW 4 149,727,673 (GRCm39) missense probably benign 0.05
R6382:Clstn1 UTSW 4 149,710,577 (GRCm39) splice site probably null
R6573:Clstn1 UTSW 4 149,728,146 (GRCm39) missense probably damaging 1.00
R7342:Clstn1 UTSW 4 149,713,887 (GRCm39) missense probably damaging 0.98
R7457:Clstn1 UTSW 4 149,719,373 (GRCm39) missense probably benign 0.03
R7571:Clstn1 UTSW 4 149,730,744 (GRCm39) missense probably benign 0.38
R7682:Clstn1 UTSW 4 149,710,558 (GRCm39) missense possibly damaging 0.72
R7738:Clstn1 UTSW 4 149,719,811 (GRCm39) missense probably damaging 1.00
R7803:Clstn1 UTSW 4 149,716,328 (GRCm39) missense probably damaging 1.00
R7918:Clstn1 UTSW 4 149,728,508 (GRCm39) missense probably damaging 0.98
R8007:Clstn1 UTSW 4 149,716,305 (GRCm39) missense probably damaging 1.00
R8821:Clstn1 UTSW 4 149,730,780 (GRCm39) missense probably benign 0.00
R8831:Clstn1 UTSW 4 149,730,780 (GRCm39) missense probably benign 0.00
R9169:Clstn1 UTSW 4 149,731,322 (GRCm39) missense possibly damaging 0.68
R9173:Clstn1 UTSW 4 149,710,564 (GRCm39) missense probably benign 0.08
R9463:Clstn1 UTSW 4 149,698,564 (GRCm39) missense possibly damaging 0.92
R9491:Clstn1 UTSW 4 149,731,929 (GRCm39) missense probably damaging 1.00
R9615:Clstn1 UTSW 4 149,722,757 (GRCm39) missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149,719,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGTGTGGAAGCCAGAC -3'
(R):5'- TTTGACCAGCAACACAGCTC -3'

Sequencing Primer
(F):5'- GACGACACATGTTCATCTTCAAAGG -3'
(R):5'- CTGTCAGCTACCTCGAGTATTACAAG -3'
Posted On 2019-12-20