Mutagenetix > Incidental Mutation

Incidental Mutation 'R7904:Clstn1'

610149

Institutional Source

Beutler Lab

Gene Symbol

Clstn1

Ensembl Gene

ENSMUSG00000039953

Gene Name

calsyntenin 1

Synonyms

Cst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha

MMRRC Submission

045956-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7904 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149586468-149648899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 149614137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 60 (I60N)

Ref Sequence

ENSEMBL: ENSMUSP00000036962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]

AlphaFold

Q9EPL2

Predicted Effect

probably benign
Transcript: ENSMUST00000039144
AA Change: I60N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: I60N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105691
AA Change: I60N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: I60N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	T	2: 130,792,003		probably null	Het
Adam8	G	A	7: 139,987,678	T384I	probably benign	Het
Astn1	T	C	1: 158,597,316	F691L	probably benign	Het
Azgp1	A	G	5: 137,987,607	E164G	probably damaging	Het
Bdp1	A	G	13: 100,041,436	V1975A	probably benign	Het
Cactin	T	C	10: 81,325,865	Y744H	possibly damaging	Het
Col16a1	T	A	4: 130,054,208	C240*	probably null	Het
Col6a5	T	C	9: 105,928,521	D1062G	unknown	Het
Csmd2	T	C	4: 128,419,553	L1341P		Het
Cyp51	A	T	5: 4,100,173	F183L	probably damaging	Het
Dbnl	T	A	11: 5,791,779		probably null	Het
Ddx60	G	A	8: 61,977,890	V820I	possibly damaging	Het
Dnah11	T	A	12: 117,903,268	D4046V	possibly damaging	Het
Dnah6	G	A	6: 73,135,467		probably null	Het
Dnttip1	A	G	2: 164,747,552	Y89C	probably benign	Het
Efr3a	T	A	15: 65,824,678	V144E	probably damaging	Het
Epha8	T	C	4: 136,931,739	Q868R	possibly damaging	Het
Ercc5	G	T	1: 44,175,838		probably null	Het
Fam118a	A	G	15: 85,045,633	S21G	probably damaging	Het
Fam171b	T	C	2: 83,853,505	I122T	probably damaging	Het
Fam205a1	A	G	4: 42,850,765	S464P	possibly damaging	Het
Fam212b	T	C	3: 105,716,414	C35R	probably damaging	Het
Fat4	T	A	3: 38,887,541	S194R	probably damaging	Het
Fcho2	T	A	13: 98,796,363	T44S	possibly damaging	Het
Gm21698	C	A	5: 25,984,258	L232F	probably benign	Het
Gm5767	A	G	16: 8,683,817	H61R		Het
Gpr149	T	A	3: 62,594,935	D500V	probably benign	Het
Gpx8	T	A	13: 113,045,501	T133S	probably benign	Het
Hdlbp	A	T	1: 93,423,370	I542N	probably damaging	Het
Hid1	G	A	11: 115,355,361	S361F	probably damaging	Het
Igdcc4	C	A	9: 65,134,519	A1076E	probably benign	Het
Il4ra	A	G	7: 125,565,673	K7E	probably benign	Het
Itga9	G	T	9: 118,877,226		probably null	Het
Kif5c	T	C	2: 49,701,083	S316P	probably damaging	Het
Kmt5c	A	T	7: 4,746,159	T264S	probably damaging	Het
Lrrc18	A	G	14: 33,009,095	N197S	probably benign	Het
Mcoln1	C	A	8: 3,508,356	D203E	probably benign	Het
Mitf	T	C	6: 98,013,710	V358A	probably damaging	Het
Mki67	A	T	7: 135,693,087	L3161Q	possibly damaging	Het
Mmp20	T	A	9: 7,644,075	F255I	possibly damaging	Het
Muc16	T	C	9: 18,655,650	T1858A	unknown	Het
Mug1	G	A	6: 121,851,465	V279I	probably benign	Het
Olfr780	T	C	10: 129,321,796	Y58H	probably damaging	Het
Otulin	G	T	15: 27,630,494	A39E	probably benign	Het
Pcdh17	A	T	14: 84,448,484	D797V	possibly damaging	Het
Pdlim5	G	A	3: 142,312,393	S147L	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Ppp2r1a	T	G	17: 20,961,741		probably null	Het
Ranbp6	T	C	19: 29,812,413	I180V	probably benign	Het
Rbm27	G	T	18: 42,332,856	R869L	probably damaging	Het
Rtn4r	A	G	16: 18,151,485	D259G	probably benign	Het
Ryr3	T	C	2: 112,781,024	E2271G	probably damaging	Het
Sbk1	A	G	7: 126,292,036	Y214C	probably damaging	Het
Scg3	C	T	9: 75,643,867	E459K	probably damaging	Het
Scin	T	G	12: 40,077,000	E449D	probably damaging	Het
Sel1l3	T	C	5: 53,139,824	K760R	probably benign	Het
Sh3pxd2a	A	G	19: 47,320,314	L145S	possibly damaging	Het
Sh3yl1	A	G	12: 30,941,996	D188G	probably benign	Het
Slc38a1	A	T	15: 96,624,040	L13Q	possibly damaging	Het
Smyd4	T	C	11: 75,349,787	I36T	possibly damaging	Het
Stab2	A	T	10: 86,954,192	L570*	probably null	Het
Tg	G	T	15: 66,705,279	A1484S	probably benign	Het
Tm7sf2	A	T	19: 6,068,912	N677K	probably damaging	Het
Tmem235	T	G	11: 117,860,891	L47R	probably damaging	Het
Tmem87a	A	G	2: 120,379,717	S252P	probably damaging	Het
Unc13b	A	G	4: 43,217,075	D458G	probably benign	Het
Wfdc1	A	G	8: 119,680,031		probably null	Het
Wnt16	A	G	6: 22,297,990	Y285C	probably damaging	Het
Wwc2	A	T	8: 47,856,235	N837K	unknown	Het
Xdh	A	G	17: 73,922,472	F329L	probably benign	Het
Yaf2	G	T	15: 93,285,585	H115N	probably benign	Het
Zbtb16	G	T	9: 48,832,972	N13K	probably damaging	Het
Zfhx3	A	T	8: 108,951,063	D2915V	probably damaging	Het
Zfp236	A	T	18: 82,609,382	V1564E	possibly damaging	Het
Zfp407	G	T	18: 84,561,256	H577Q	not run	Het

Other mutations in Clstn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clstn1	APN	4	149635243	missense	probably damaging	0.99
IGL00585:Clstn1	APN	4	149638312	missense	probably benign	0.05
IGL00911:Clstn1	APN	4	149643191	splice site	probably benign
IGL01394:Clstn1	APN	4	149634782	missense	possibly damaging	0.87
IGL02193:Clstn1	APN	4	149645352	missense	probably benign	0.03
IGL02406:Clstn1	APN	4	149627359	missense	probably damaging	1.00
IGL02501:Clstn1	APN	4	149631842	missense	probably damaging	1.00
IGL02641:Clstn1	APN	4	149629511	missense	probably null	1.00
R0012:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0020:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0021:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0026:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0031:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0038:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0062:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0064:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0193:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0279:Clstn1	UTSW	4	149643674	missense	probably damaging	1.00
R0394:Clstn1	UTSW	4	149644178	missense	probably benign	0.00
R0609:Clstn1	UTSW	4	149629300	splice site	probably null
R0685:Clstn1	UTSW	4	149646855	missense	probably benign	0.24
R0724:Clstn1	UTSW	4	149643624	missense	possibly damaging	0.84
R1016:Clstn1	UTSW	4	149646829	missense	probably benign	0.21
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1622:Clstn1	UTSW	4	149629407	missense	probably damaging	0.97
R1680:Clstn1	UTSW	4	149643726	missense	probably benign	0.02
R3803:Clstn1	UTSW	4	149635339	missense	probably damaging	0.99
R3836:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R3838:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R4923:Clstn1	UTSW	4	149645029	missense	probably benign	0.07
R5024:Clstn1	UTSW	4	149635294	missense	possibly damaging	0.91
R5919:Clstn1	UTSW	4	149635246	missense	probably damaging	1.00
R6269:Clstn1	UTSW	4	149644067	missense	probably benign	0.00
R6354:Clstn1	UTSW	4	149643216	missense	probably benign	0.05
R6382:Clstn1	UTSW	4	149626120	splice site	probably null
R6573:Clstn1	UTSW	4	149643689	missense	probably damaging	1.00
R7342:Clstn1	UTSW	4	149629430	missense	probably damaging	0.98
R7457:Clstn1	UTSW	4	149634916	missense	probably benign	0.03
R7571:Clstn1	UTSW	4	149646287	missense	probably benign	0.38
R7682:Clstn1	UTSW	4	149626101	missense	possibly damaging	0.72
R7738:Clstn1	UTSW	4	149635354	missense	probably damaging	1.00
R7803:Clstn1	UTSW	4	149631871	missense	probably damaging	1.00
R7918:Clstn1	UTSW	4	149644051	missense	probably damaging	0.98
R8007:Clstn1	UTSW	4	149631848	missense	probably damaging	1.00
R8821:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R8831:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R9169:Clstn1	UTSW	4	149646865	missense	possibly damaging	0.68
R9173:Clstn1	UTSW	4	149626107	missense	probably benign	0.08
R9463:Clstn1	UTSW	4	149614107	missense	possibly damaging	0.92
R9491:Clstn1	UTSW	4	149647472	missense	probably damaging	1.00
R9615:Clstn1	UTSW	4	149638300	missense	probably damaging	1.00
X0020:Clstn1	UTSW	4	149635251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTTGTGTGGAAGCCAGAC -3'
(R):5'- TTTGACCAGCAACACAGCTC -3'

Sequencing Primer
(F):5'- GACGACACATGTTCATCTTCAAAGG -3'
(R):5'- CTGTCAGCTACCTCGAGTATTACAAG -3'

Posted On

2019-12-20