Incidental Mutation 'R7904:Zbtb16'
ID610169
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Namezinc finger and BTB domain containing 16
SynonymsGreen's luxoid, Zfp145, PLZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R7904 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location48654297-48836222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48832972 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 13 (N13K)
Ref Sequence ENSEMBL: ENSMUSP00000091374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
Predicted Effect probably damaging
Transcript: ENSMUST00000093852
AA Change: N13K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: N13K

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000216150
AA Change: N13K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,792,003 probably null Het
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Dbnl T A 11: 5,791,779 probably null Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnah6 G A 6: 73,135,467 probably null Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Itga9 G T 9: 118,877,226 probably null Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wfdc1 A G 8: 119,680,031 probably null Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48665275 missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R4595:Zbtb16 UTSW 9 48832080 missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48832404 missense possibly damaging 0.93
R7751:Zbtb16 UTSW 9 48743469 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCCAGGATCTGCTGGAAGG -3'
(R):5'- ACTGGGGAAGTTGTTGTCAC -3'

Sequencing Primer
(F):5'- GAAGTCTAGAGTATAGTGCTGGC -3'
(R):5'- GGAAGTTGTTGTCACTTGCTCACC -3'
Posted On2019-12-20