Incidental Mutation 'R7904:Scg3'
ID610171
Institutional Source Beutler Lab
Gene Symbol Scg3
Ensembl Gene ENSMUSG00000032181
Gene Namesecretogranin III
SynonymsSgIII, Chgd, 1B1075
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7904 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location75643189-75684056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75643867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 459 (E459K)
Ref Sequence ENSEMBL: ENSMUSP00000034699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]
Predicted Effect probably damaging
Transcript: ENSMUST00000034699
AA Change: E459K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181
AA Change: E459K

DomainStartEndE-ValueType
Pfam:SGIII 20 471 1.3e-215 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213324
AA Change: E454K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Scg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Scg3 APN 9 75663237 missense probably damaging 1.00
IGL02221:Scg3 APN 9 75683657 missense probably damaging 0.99
IGL03391:Scg3 APN 9 75661251 critical splice donor site probably null
R0137:Scg3 UTSW 9 75663180 unclassified probably benign
R0366:Scg3 UTSW 9 75675338 splice site probably benign
R0650:Scg3 UTSW 9 75669335 missense probably damaging 1.00
R0654:Scg3 UTSW 9 75665735 missense probably damaging 1.00
R0666:Scg3 UTSW 9 75643940 nonsense probably null
R0827:Scg3 UTSW 9 75683697 missense possibly damaging 0.81
R1317:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1553:Scg3 UTSW 9 75669304 missense probably null 1.00
R1751:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1761:Scg3 UTSW 9 75676758 missense probably damaging 1.00
R1850:Scg3 UTSW 9 75682167 missense possibly damaging 0.56
R2059:Scg3 UTSW 9 75665716 missense probably damaging 1.00
R2137:Scg3 UTSW 9 75676810 missense probably damaging 0.96
R2384:Scg3 UTSW 9 75665726 missense probably damaging 1.00
R3870:Scg3 UTSW 9 75675499 splice site probably benign
R4260:Scg3 UTSW 9 75651697 missense probably damaging 1.00
R5371:Scg3 UTSW 9 75661301 missense probably damaging 1.00
R5417:Scg3 UTSW 9 75669256 missense probably benign 0.02
R6013:Scg3 UTSW 9 75676808 missense probably damaging 1.00
R7052:Scg3 UTSW 9 75661382 nonsense probably null
R7202:Scg3 UTSW 9 75683710 missense probably benign 0.06
R7211:Scg3 UTSW 9 75682084 missense probably benign 0.00
R7471:Scg3 UTSW 9 75682092 missense probably damaging 1.00
R7490:Scg3 UTSW 9 75669277 missense possibly damaging 0.94
R7651:Scg3 UTSW 9 75682050 missense probably benign 0.03
R7987:Scg3 UTSW 9 75643867 missense probably damaging 1.00
Z1176:Scg3 UTSW 9 75669316 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTAGGTTCAGACTTATGTTCAACCC -3'
(R):5'- GTATGGCCCAAACCCAGAAG -3'

Sequencing Primer
(F):5'- AGAGTCTTTTCCAGAGCAGC -3'
(R):5'- CAGAAGAACTTCCTGTCCTTCAATG -3'
Posted On2019-12-20