Incidental Mutation 'R7904:Sh3yl1'
ID610179
Institutional Source Beutler Lab
Gene Symbol Sh3yl1
Ensembl Gene ENSMUSG00000020669
Gene NameSh3 domain YSC-like 1
SynonymsYSC84, Ray
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7904 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location30911668-30960162 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30941996 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000020997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020997] [ENSMUST00000110880]
Predicted Effect probably benign
Transcript: ENSMUST00000020997
AA Change: D188G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020997
Gene: ENSMUSG00000020669
AA Change: D188G

DomainStartEndE-ValueType
Pfam:Ysc84 86 209 1.9e-42 PFAM
SH3 284 340 9.6e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110880
AA Change: D150G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106504
Gene: ENSMUSG00000020669
AA Change: D150G

DomainStartEndE-ValueType
Pfam:DUF500 47 172 2.9e-44 PFAM
SH3 246 302 9.6e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Sh3yl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Sh3yl1 APN 12 30939564 splice site probably benign
IGL02129:Sh3yl1 APN 12 30942877 splice site probably benign
IGL02448:Sh3yl1 APN 12 30939667 missense probably damaging 0.99
IGL03181:Sh3yl1 APN 12 30941980 missense possibly damaging 0.74
IGL03381:Sh3yl1 APN 12 30926837 missense possibly damaging 0.94
R1954:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1955:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1956:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R1957:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R2248:Sh3yl1 UTSW 12 30942870 critical splice donor site probably null
R3430:Sh3yl1 UTSW 12 30959842 missense probably benign 0.00
R4776:Sh3yl1 UTSW 12 30940314 missense probably damaging 1.00
R5505:Sh3yl1 UTSW 12 30942073 missense probably damaging 1.00
R6152:Sh3yl1 UTSW 12 30942035 missense probably benign 0.01
R7075:Sh3yl1 UTSW 12 30940166 intron probably null
R7765:Sh3yl1 UTSW 12 30958869 missense probably damaging 1.00
R7987:Sh3yl1 UTSW 12 30941996 missense probably benign
R8036:Sh3yl1 UTSW 12 30942099 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGTTTGGGGTAAGCCTAATAGTGAG -3'
(R):5'- TATTGCTGGGAACTTGCGC -3'

Sequencing Primer
(F):5'- CCTAATAGTGAGACATGGAGTAAGAC -3'
(R):5'- AACTTGCGCTCAGAGCTGTG -3'
Posted On2019-12-20