Incidental Mutation 'R7904:Ppp2r1a'
ID610195
Institutional Source Beutler Lab
Gene Symbol Ppp2r1a
Ensembl Gene ENSMUSG00000007564
Gene Nameprotein phosphatase 2, regulatory subunit A, alpha
SynonymsPR65, PP2A, 6330556D22Rik, protein phosphatase PP2A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7904 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20945311-20965916 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 20961741 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]
PDB Structure
Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. [X-RAY DIFFRACTION]
Crystal structure of the full-length simian virus 40 small t antigen complexed with the protein phosphatase 2A Aalpha subunit [X-RAY DIFFRACTION]
Structural Basis of PP2A and Sgo interaction [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000007708
SMART Domains Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 166 196 4.3e-6 PFAM
Pfam:HEAT_2 170 266 1.7e-8 PFAM
Pfam:HEAT 283 313 3.4e-5 PFAM
Pfam:HEAT_2 366 467 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147983
SMART Domains Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 13 43 2.1e-5 PFAM
Pfam:HEAT 52 82 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173658
SMART Domains Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
PDB:2PF4|D 1 72 3e-40 PDB
SCOP:d1b3ua_ 2 86 3e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Ppp2r1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp2r1a APN 17 20961578 unclassified probably benign
IGL01815:Ppp2r1a APN 17 20956832 missense probably benign 0.00
IGL01923:Ppp2r1a APN 17 20965469 makesense probably null
IGL02411:Ppp2r1a APN 17 20951334 splice site probably benign
IGL02694:Ppp2r1a APN 17 20951440 splice site probably benign
IGL02742:Ppp2r1a APN 17 20959003 missense probably benign 0.01
Dolmas UTSW 17 20960631 nonsense probably null
R0032:Ppp2r1a UTSW 17 20945584 critical splice donor site probably benign
R0403:Ppp2r1a UTSW 17 20957041 missense probably damaging 0.96
R1170:Ppp2r1a UTSW 17 20951331 splice site probably benign
R1652:Ppp2r1a UTSW 17 20955974 missense probably benign 0.03
R1857:Ppp2r1a UTSW 17 20961689 missense possibly damaging 0.93
R2215:Ppp2r1a UTSW 17 20961743 splice site probably null
R3800:Ppp2r1a UTSW 17 20962710 missense possibly damaging 0.82
R4013:Ppp2r1a UTSW 17 20951347 missense probably damaging 1.00
R4483:Ppp2r1a UTSW 17 20955810 missense probably benign 0.05
R5014:Ppp2r1a UTSW 17 20958839 splice site probably null
R5421:Ppp2r1a UTSW 17 20956706 missense probably benign
R5615:Ppp2r1a UTSW 17 20958987 missense probably benign 0.00
R5945:Ppp2r1a UTSW 17 20959413 missense possibly damaging 0.81
R5986:Ppp2r1a UTSW 17 20951346 missense probably damaging 1.00
R6466:Ppp2r1a UTSW 17 20960631 nonsense probably null
R6727:Ppp2r1a UTSW 17 20955825 missense probably benign 0.07
R6738:Ppp2r1a UTSW 17 20954717 critical splice donor site probably null
R6934:Ppp2r1a UTSW 17 20961633 missense possibly damaging 0.56
R7549:Ppp2r1a UTSW 17 20962682 missense possibly damaging 0.95
R7987:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7998:Ppp2r1a UTSW 17 20961639 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTAATGCCCTCCTGCTCAG -3'
(R):5'- ATGCAATCTTGGCCCTGTAG -3'

Sequencing Primer
(F):5'- GCTCAGTCCTTCATCTTGAATCAC -3'
(R):5'- AATCTTGGCCCTGTAGAGACC -3'
Posted On2019-12-20