Incidental Mutation 'R7904:Sh3pxd2a'
ID 610202
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2a
Ensembl Gene ENSMUSG00000053617
Gene Name SH3 and PX domains 2A
Synonyms Tks5, Fish, Sh3md1, 2310014D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7904 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 47260174-47464411 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47320314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 145 (L145S)
Ref Sequence ENSEMBL: ENSMUSP00000080325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]
AlphaFold O89032
Predicted Effect possibly damaging
Transcript: ENSMUST00000081619
AA Change: L145S

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: L145S

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111800
AA Change: L145S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: L145S

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,792,003 probably null Het
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Dbnl T A 11: 5,791,779 probably null Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnah6 G A 6: 73,135,467 probably null Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Itga9 G T 9: 118,877,226 probably null Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sel1l3 T C 5: 53,139,824 K760R probably benign Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wfdc1 A G 8: 119,680,031 probably null Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Sh3pxd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Sh3pxd2a APN 19 47314155 missense probably benign 0.20
IGL01606:Sh3pxd2a APN 19 47268596 missense probably benign
IGL02001:Sh3pxd2a APN 19 47273447 missense probably damaging 0.99
IGL02060:Sh3pxd2a APN 19 47373378 splice site probably benign
IGL02830:Sh3pxd2a APN 19 47283078 missense probably damaging 1.00
IGL03240:Sh3pxd2a APN 19 47268026 missense probably damaging 1.00
IGL03263:Sh3pxd2a APN 19 47314043 missense probably damaging 1.00
IGL03290:Sh3pxd2a APN 19 47424516 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0504:Sh3pxd2a UTSW 19 47267747 missense probably damaging 1.00
R0683:Sh3pxd2a UTSW 19 47267511 missense probably benign 0.04
R0726:Sh3pxd2a UTSW 19 47268762 missense probably damaging 1.00
R0883:Sh3pxd2a UTSW 19 47268207 missense probably damaging 1.00
R1276:Sh3pxd2a UTSW 19 47268383 missense probably benign
R1349:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1372:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1525:Sh3pxd2a UTSW 19 47278425 missense probably damaging 1.00
R1661:Sh3pxd2a UTSW 19 47278320 missense probably damaging 1.00
R1664:Sh3pxd2a UTSW 19 47268382 missense probably benign 0.02
R1766:Sh3pxd2a UTSW 19 47273250 missense probably benign 0.01
R1931:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R1932:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R2024:Sh3pxd2a UTSW 19 47267264 missense probably benign 0.35
R2165:Sh3pxd2a UTSW 19 47278355 missense probably damaging 1.00
R2210:Sh3pxd2a UTSW 19 47267343 missense possibly damaging 0.93
R2567:Sh3pxd2a UTSW 19 47424569 missense possibly damaging 0.94
R4097:Sh3pxd2a UTSW 19 47424512 missense probably damaging 1.00
R4466:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R4788:Sh3pxd2a UTSW 19 47314079 missense probably damaging 1.00
R4885:Sh3pxd2a UTSW 19 47268693 missense probably damaging 1.00
R4939:Sh3pxd2a UTSW 19 47278404 missense probably damaging 1.00
R5184:Sh3pxd2a UTSW 19 47273411 missense possibly damaging 0.90
R5340:Sh3pxd2a UTSW 19 47268231 missense probably benign 0.36
R5673:Sh3pxd2a UTSW 19 47268666 missense probably damaging 1.00
R5925:Sh3pxd2a UTSW 19 47267612 missense probably damaging 1.00
R5988:Sh3pxd2a UTSW 19 47364638 missense probably benign 0.16
R6120:Sh3pxd2a UTSW 19 47267409 missense probably damaging 0.99
R6432:Sh3pxd2a UTSW 19 47269927 missense probably damaging 0.99
R6650:Sh3pxd2a UTSW 19 47268224 missense probably benign 0.00
R6700:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R6831:Sh3pxd2a UTSW 19 47283093 missense probably damaging 1.00
R7015:Sh3pxd2a UTSW 19 47268123 missense probably benign 0.00
R7225:Sh3pxd2a UTSW 19 47267389 missense probably damaging 1.00
R7449:Sh3pxd2a UTSW 19 47267652 missense probably benign
R7695:Sh3pxd2a UTSW 19 47267831 missense probably damaging 1.00
R8143:Sh3pxd2a UTSW 19 47268699 missense probably damaging 1.00
R8268:Sh3pxd2a UTSW 19 47267594 missense probably benign
R8290:Sh3pxd2a UTSW 19 47314136 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47268707 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47269838 missense probably null 0.72
R8742:Sh3pxd2a UTSW 19 47286634 missense probably benign 0.01
R8767:Sh3pxd2a UTSW 19 47268906 missense probably damaging 1.00
R8948:Sh3pxd2a UTSW 19 47373443 missense probably damaging 1.00
R9357:Sh3pxd2a UTSW 19 47272009 missense probably damaging 1.00
R9433:Sh3pxd2a UTSW 19 47267100 missense probably damaging 0.98
R9515:Sh3pxd2a UTSW 19 47267171 missense probably damaging 1.00
R9748:Sh3pxd2a UTSW 19 47268654 missense probably benign
V3553:Sh3pxd2a UTSW 19 47267219 missense probably benign 0.12
X0013:Sh3pxd2a UTSW 19 47267864 missense probably benign 0.01
X0026:Sh3pxd2a UTSW 19 47464150 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTCATCTGAGGATGGTAAAGG -3'
(R):5'- TGTAATCATACAGGCCCACGC -3'

Sequencing Primer
(F):5'- CATCTGAGGATGGTAAAGGGCTCTC -3'
(R):5'- GCCCAGCAGTCATCCCCAG -3'
Posted On 2019-12-20