Incidental Mutation 'R7905:Adcy10'
ID 610204
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 045957-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.376) question?
Stock # R7905 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 165513168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably null
Transcript: ENSMUST00000027852
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111439
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111440
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 (GRCm38) I358T probably benign Het
Actl9 T C 17: 33,433,827 (GRCm38) V287A possibly damaging Het
Aox1 G A 1: 58,104,398 (GRCm38) S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 (GRCm38) S96R probably benign Het
Bpifa5 T C 2: 154,165,588 (GRCm38) I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 (GRCm38) V181D probably benign Het
Cd40 T C 2: 165,062,325 (GRCm38) Y31H probably damaging Het
Cep290 A G 10: 100,554,490 (GRCm38) T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 (GRCm38) K158R possibly damaging Het
Degs1 A C 1: 182,279,036 (GRCm38) N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 (GRCm38) P98S probably benign Het
Dll3 T G 7: 28,301,535 (GRCm38) I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 (GRCm38) I278F probably damaging Het
Ets2 T A 16: 95,706,437 (GRCm38) I6N probably damaging Het
Gbp4 A G 5: 105,121,087 (GRCm38) F400S probably damaging Het
Golgb1 C T 16: 36,913,685 (GRCm38) A1139V probably benign Het
Hfm1 A T 5: 106,898,553 (GRCm38) L489H probably damaging Het
Kcna5 T C 6: 126,534,868 (GRCm38) D99G probably benign Het
Ldhc A G 7: 46,875,531 (GRCm38) probably null Het
Mief1 C G 15: 80,249,398 (GRCm38) P219A probably damaging Het
Myh11 A T 16: 14,207,681 (GRCm38) Y1408* probably null Het
Myo1b A G 1: 51,763,884 (GRCm38) probably null Het
Nedd4 A T 9: 72,677,379 (GRCm38) K121* probably null Het
Nek9 A C 12: 85,305,596 (GRCm38) M831R probably damaging Het
Nf1 G A 11: 79,547,112 (GRCm38) A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 (GRCm38) I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 (GRCm38) probably null Het
Pcdhb6 T C 18: 37,334,554 (GRCm38) L176P probably benign Het
Plxnb1 G A 9: 109,109,232 (GRCm38) V1285M probably damaging Het
Psg26 T A 7: 18,475,317 (GRCm38) M389L probably benign Het
Slc4a10 A G 2: 62,268,151 (GRCm38) E543G probably damaging Het
Spink7 G T 18: 62,592,416 (GRCm38) C85* probably null Het
Stard9 T C 2: 120,696,081 (GRCm38) W940R not run Het
Susd2 A T 10: 75,639,657 (GRCm38) L471* probably null Het
Taf2 A T 15: 55,047,432 (GRCm38) D615E possibly damaging Het
Taf4 G A 2: 179,932,029 (GRCm38) T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 (GRCm38) S14P Het
Tha1 A C 11: 117,871,067 (GRCm38) V116G possibly damaging Het
Trim46 T C 3: 89,244,326 (GRCm38) H50R probably damaging Het
Trit1 A G 4: 123,016,715 (GRCm38) K36E probably damaging Het
Ttc13 A T 8: 124,688,596 (GRCm38) M268K probably benign Het
Ufc1 T A 1: 171,289,935 (GRCm38) K68N probably damaging Het
Zbbx T C 3: 75,085,513 (GRCm38) T225A probably benign Het
Zfp768 T C 7: 127,344,659 (GRCm38) E102G probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,551,914 (GRCm38) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,572,614 (GRCm38) missense probably benign
IGL01099:Adcy10 APN 1 165,539,842 (GRCm38) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,546,587 (GRCm38) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,513,168 (GRCm38) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,521,843 (GRCm38) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,570,620 (GRCm38) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,572,543 (GRCm38) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,559,128 (GRCm38) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,538,380 (GRCm38) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,510,408 (GRCm38) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,570,744 (GRCm38) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,567,726 (GRCm38) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,543,233 (GRCm38) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,519,518 (GRCm38) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,538,475 (GRCm38) nonsense probably null
Bugged UTSW 1 165,564,237 (GRCm38) missense probably damaging 0.99
debye UTSW 1 165,551,361 (GRCm38) critical splice donor site probably null
malaysian UTSW 1 165,513,127 (GRCm38) missense probably benign 0.38
singaporean UTSW 1 165,518,312 (GRCm38) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,556,791 (GRCm38) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,539,834 (GRCm38) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,539,834 (GRCm38) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,572,591 (GRCm38) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,564,249 (GRCm38) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,552,022 (GRCm38) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,570,728 (GRCm38) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,510,390 (GRCm38) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,519,519 (GRCm38) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,564,023 (GRCm38) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,565,315 (GRCm38) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,513,130 (GRCm38) missense probably benign
R0597:Adcy10 UTSW 1 165,525,062 (GRCm38) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,543,105 (GRCm38) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,563,947 (GRCm38) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,515,380 (GRCm38) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,518,403 (GRCm38) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,518,312 (GRCm38) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,525,033 (GRCm38) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,519,925 (GRCm38) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,503,243 (GRCm38) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,521,961 (GRCm38) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,570,808 (GRCm38) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,510,297 (GRCm38) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,525,022 (GRCm38) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,518,212 (GRCm38) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,518,260 (GRCm38) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,518,260 (GRCm38) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,510,297 (GRCm38) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,558,597 (GRCm38) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,575,727 (GRCm38) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,513,127 (GRCm38) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,551,361 (GRCm38) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,504,049 (GRCm38) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,506,644 (GRCm38) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,548,213 (GRCm38) missense probably benign
R4916:Adcy10 UTSW 1 165,518,246 (GRCm38) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,563,963 (GRCm38) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,556,862 (GRCm38) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,519,500 (GRCm38) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,519,895 (GRCm38) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,513,140 (GRCm38) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,515,306 (GRCm38) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,539,817 (GRCm38) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,541,649 (GRCm38) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,575,728 (GRCm38) nonsense probably null
R6455:Adcy10 UTSW 1 165,518,374 (GRCm38) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,575,658 (GRCm38) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,506,635 (GRCm38) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,564,285 (GRCm38) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,556,916 (GRCm38) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,518,246 (GRCm38) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,539,874 (GRCm38) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,538,522 (GRCm38) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,504,047 (GRCm38) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,510,370 (GRCm38) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,543,470 (GRCm38) splice site probably null
R7228:Adcy10 UTSW 1 165,510,272 (GRCm38) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,576,608 (GRCm38) missense unknown
R7561:Adcy10 UTSW 1 165,559,172 (GRCm38) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,564,237 (GRCm38) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,570,771 (GRCm38) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,515,369 (GRCm38) missense probably damaging 1.00
R8040:Adcy10 UTSW 1 165,552,024 (GRCm38) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,546,549 (GRCm38) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,503,288 (GRCm38) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,510,337 (GRCm38) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,551,298 (GRCm38) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,518,345 (GRCm38) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,575,649 (GRCm38) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,543,110 (GRCm38) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,513,112 (GRCm38) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,552,109 (GRCm38) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,510,276 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTGTGTGTCCTGTACTAGAC -3'
(R):5'- TTAGTGTTTGGAAGCAGACAGATG -3'

Sequencing Primer
(F):5'- CCTGTACTAGACATACTGTTTGCAGG -3'
(R):5'- AGGAGGCTAGCTAGGTACCC -3'
Posted On 2019-12-20