Incidental Mutation 'R7905:Trit1'
ID610215
Institutional Source Beutler Lab
Gene Symbol Trit1
Ensembl Gene ENSMUSG00000028653
Gene NametRNA isopentenyltransferase 1
Synonyms2310075G14Rik, MOD5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123016597-123054949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123016715 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 36 (K36E)
Ref Sequence ENSEMBL: ENSMUSP00000099709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102649]
Predicted Effect probably damaging
Transcript: ENSMUST00000102649
AA Change: K36E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099709
Gene: ENSMUSG00000028653
AA Change: K36E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:IPT 23 109 2e-6 PFAM
Pfam:IPPT 58 335 1.9e-66 PFAM
Pfam:zf-C2H2_jaz 394 420 7.4e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that that is targeted to the mitochondrion and modifies transfer RNAs (tRNAs) by adding a dimethylallyl group onto the adenine at position 37. This modification is important for maintaining the correct reading frame during protein translation. This gene is considered a tumor suppressor and its expression can decrease cell growth. Alternative splicing results in multiple transcripts variants, most of which are likely non-functional. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Trit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Trit1 APN 4 123049551 missense probably benign 0.16
R1675:Trit1 UTSW 4 123054236 missense possibly damaging 0.82
R1935:Trit1 UTSW 4 123054240 missense probably benign 0.00
R1936:Trit1 UTSW 4 123054240 missense probably benign 0.00
R1940:Trit1 UTSW 4 123054240 missense probably benign 0.00
R4801:Trit1 UTSW 4 123016638 missense probably benign 0.40
R4802:Trit1 UTSW 4 123016638 missense probably benign 0.40
R5106:Trit1 UTSW 4 123054313 utr 3 prime probably benign
R5644:Trit1 UTSW 4 123049172 missense probably damaging 1.00
R6122:Trit1 UTSW 4 123039468 missense possibly damaging 0.95
R6403:Trit1 UTSW 4 123039579 missense possibly damaging 0.67
R7335:Trit1 UTSW 4 123016779 missense possibly damaging 0.89
R8138:Trit1 UTSW 4 123043789 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGTACCTTTGTCCCACAG -3'
(R):5'- TCATCTGGATCCCCATACGC -3'

Sequencing Primer
(F):5'- CGTTCTGAGCCGGAGATC -3'
(R):5'- ATACGCCTCGAGGTTCACC -3'
Posted On2019-12-20