Incidental Mutation 'R7905:Psg26'
ID610219
Institutional Source Beutler Lab
Gene Symbol Psg26
Ensembl Gene ENSMUSG00000070799
Gene Namepregnancy-specific glycoprotein 26
SynonymsEG574429, cea14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18474582-18484177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18475317 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 389 (M389L)
Ref Sequence ENSEMBL: ENSMUSP00000092392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094798]
Predicted Effect probably benign
Transcript: ENSMUST00000094798
AA Change: M389L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092392
Gene: ENSMUSG00000070799
AA Change: M389L

DomainStartEndE-ValueType
IG 40 141 4.93e-3 SMART
IG 160 261 2.39e-1 SMART
IG 280 379 6.07e-3 SMART
IGc2 397 461 5.48e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Psg26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Psg26 APN 7 18478330 missense possibly damaging 0.83
IGL01383:Psg26 APN 7 18480254 missense possibly damaging 0.90
IGL01453:Psg26 APN 7 18480074 missense possibly damaging 0.91
IGL01603:Psg26 APN 7 18475103 missense probably damaging 0.98
IGL02201:Psg26 APN 7 18480146 missense probably benign 0.04
IGL02468:Psg26 APN 7 18478462 missense probably damaging 0.96
IGL02648:Psg26 APN 7 18482766 missense probably benign 0.05
IGL02812:Psg26 APN 7 18475155 missense probably benign 0.00
R0226:Psg26 UTSW 7 18483958 missense possibly damaging 0.81
R0352:Psg26 UTSW 7 18475256 missense probably benign 0.00
R0369:Psg26 UTSW 7 18482556 nonsense probably null
R0718:Psg26 UTSW 7 18475235 missense probably benign 0.23
R0718:Psg26 UTSW 7 18478287 missense probably benign 0.18
R1710:Psg26 UTSW 7 18480041 missense probably damaging 0.99
R1899:Psg26 UTSW 7 18478425 missense probably benign 0.01
R1958:Psg26 UTSW 7 18478339 missense probably benign 0.04
R2102:Psg26 UTSW 7 18475142 missense probably damaging 1.00
R3766:Psg26 UTSW 7 18475071 missense probably benign
R4544:Psg26 UTSW 7 18478539 missense probably damaging 1.00
R4977:Psg26 UTSW 7 18475310 missense probably benign 0.11
R5000:Psg26 UTSW 7 18480132 missense possibly damaging 0.95
R5376:Psg26 UTSW 7 18480105 missense probably benign
R5416:Psg26 UTSW 7 18482600 missense probably benign
R5435:Psg26 UTSW 7 18478473 missense possibly damaging 0.60
R6000:Psg26 UTSW 7 18482692 nonsense probably null
R6285:Psg26 UTSW 7 18482828 missense probably benign
R7062:Psg26 UTSW 7 18482596 missense probably damaging 1.00
R7083:Psg26 UTSW 7 18480009 nonsense probably null
R7513:Psg26 UTSW 7 18475300 missense probably benign 0.03
R7817:Psg26 UTSW 7 18482647 missense not run
R7857:Psg26 UTSW 7 18478290 missense possibly damaging 0.71
R8047:Psg26 UTSW 7 18478549 missense possibly damaging 0.50
R8789:Psg26 UTSW 7 18482569 missense probably damaging 1.00
R8877:Psg26 UTSW 7 18483940 missense probably benign 0.01
Z1177:Psg26 UTSW 7 18480291 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGACTGGTCTTTGAGCTGAC -3'
(R):5'- TTGGCAAATGCAAAGCACAC -3'

Sequencing Primer
(F):5'- TGAAGGCCTCACATTGGTAC -3'
(R):5'- CACGATATGAGTGTAGTCACAGTTCC -3'
Posted On2019-12-20