Incidental Mutation 'R7905:Psg26'
ID 610219
Institutional Source Beutler Lab
Gene Symbol Psg26
Ensembl Gene ENSMUSG00000070799
Gene Name pregnancy-specific beta-1-glycoprotein 26
Synonyms EG574429, cea14
MMRRC Submission 045957-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R7905 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18208507-18218102 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18209242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 389 (M389L)
Ref Sequence ENSEMBL: ENSMUSP00000092392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094798]
AlphaFold Q4KL65
Predicted Effect probably benign
Transcript: ENSMUST00000094798
AA Change: M389L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092392
Gene: ENSMUSG00000070799
AA Change: M389L

DomainStartEndE-ValueType
IG 40 141 4.93e-3 SMART
IG 160 261 2.39e-1 SMART
IG 280 379 6.07e-3 SMART
IGc2 397 461 5.48e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,801 (GRCm39) V287A possibly damaging Het
Adcy10 T A 1: 165,340,737 (GRCm39) probably null Het
Aox1 G A 1: 58,143,557 (GRCm39) S1225N possibly damaging Het
B430306N03Rik T A 17: 48,623,988 (GRCm39) S96R probably benign Het
Bpifa5 T C 2: 154,007,508 (GRCm39) I150T probably damaging Het
Ccdc28a A T 10: 18,094,076 (GRCm39) V181D probably benign Het
Cd40 T C 2: 164,904,245 (GRCm39) Y31H probably damaging Het
Cep290 A G 10: 100,390,352 (GRCm39) T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 (GRCm39) K158R possibly damaging Het
Degs1 A C 1: 182,106,601 (GRCm39) N255K possibly damaging Het
Dll3 T G 7: 28,000,960 (GRCm39) I32L possibly damaging Het
Dsg4 A T 18: 20,587,726 (GRCm39) I278F probably damaging Het
Ets2 T A 16: 95,507,304 (GRCm39) I6N probably damaging Het
Gbp4 A G 5: 105,268,953 (GRCm39) F400S probably damaging Het
Golgb1 C T 16: 36,734,047 (GRCm39) A1139V probably benign Het
Hfm1 A T 5: 107,046,419 (GRCm39) L489H probably damaging Het
Kcna5 T C 6: 126,511,831 (GRCm39) D99G probably benign Het
Ldhc A G 7: 46,524,955 (GRCm39) probably null Het
Mief1 C G 15: 80,133,599 (GRCm39) P219A probably damaging Het
Myh11 A T 16: 14,025,545 (GRCm39) Y1408* probably null Het
Myo1b A G 1: 51,803,043 (GRCm39) probably null Het
Nedd4 A T 9: 72,584,661 (GRCm39) K121* probably null Het
Nek9 A C 12: 85,352,370 (GRCm39) M831R probably damaging Het
Nf1 G A 11: 79,437,938 (GRCm39) A83T possibly damaging Het
Or6c203 A T 10: 129,010,056 (GRCm39) I278N probably damaging Het
Osbpl10 T C 9: 114,891,078 (GRCm39) probably null Het
Pcdhb6 T C 18: 37,467,607 (GRCm39) L176P probably benign Het
Plxnb1 G A 9: 108,938,300 (GRCm39) V1285M probably damaging Het
Slc49a4 G A 16: 35,589,320 (GRCm39) P98S probably benign Het
Slc4a10 A G 2: 62,098,495 (GRCm39) E543G probably damaging Het
Spata31h1 A G 10: 82,131,936 (GRCm39) I358T probably benign Het
Spink7 G T 18: 62,725,487 (GRCm39) C85* probably null Het
Stard9 T C 2: 120,526,562 (GRCm39) W940R not run Het
Susd2 A T 10: 75,475,491 (GRCm39) L471* probably null Het
Taf2 A T 15: 54,910,828 (GRCm39) D615E possibly damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tfdp2 T C 9: 96,192,659 (GRCm39) S14P Het
Tha1 A C 11: 117,761,893 (GRCm39) V116G possibly damaging Het
Trim46 T C 3: 89,151,633 (GRCm39) H50R probably damaging Het
Trit1 A G 4: 122,910,508 (GRCm39) K36E probably damaging Het
Ttc13 A T 8: 125,415,335 (GRCm39) M268K probably benign Het
Ufc1 T A 1: 171,117,508 (GRCm39) K68N probably damaging Het
Zbbx T C 3: 74,992,820 (GRCm39) T225A probably benign Het
Zfp768 T C 7: 126,943,831 (GRCm39) E102G probably damaging Het
Other mutations in Psg26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Psg26 APN 7 18,212,255 (GRCm39) missense possibly damaging 0.83
IGL01383:Psg26 APN 7 18,214,179 (GRCm39) missense possibly damaging 0.90
IGL01453:Psg26 APN 7 18,213,999 (GRCm39) missense possibly damaging 0.91
IGL01603:Psg26 APN 7 18,209,028 (GRCm39) missense probably damaging 0.98
IGL02201:Psg26 APN 7 18,214,071 (GRCm39) missense probably benign 0.04
IGL02468:Psg26 APN 7 18,212,387 (GRCm39) missense probably damaging 0.96
IGL02648:Psg26 APN 7 18,216,691 (GRCm39) missense probably benign 0.05
IGL02812:Psg26 APN 7 18,209,080 (GRCm39) missense probably benign 0.00
R0226:Psg26 UTSW 7 18,217,883 (GRCm39) missense possibly damaging 0.81
R0352:Psg26 UTSW 7 18,209,181 (GRCm39) missense probably benign 0.00
R0369:Psg26 UTSW 7 18,216,481 (GRCm39) nonsense probably null
R0718:Psg26 UTSW 7 18,212,212 (GRCm39) missense probably benign 0.18
R0718:Psg26 UTSW 7 18,209,160 (GRCm39) missense probably benign 0.23
R1710:Psg26 UTSW 7 18,213,966 (GRCm39) missense probably damaging 0.99
R1899:Psg26 UTSW 7 18,212,350 (GRCm39) missense probably benign 0.01
R1958:Psg26 UTSW 7 18,212,264 (GRCm39) missense probably benign 0.04
R2102:Psg26 UTSW 7 18,209,067 (GRCm39) missense probably damaging 1.00
R3766:Psg26 UTSW 7 18,208,996 (GRCm39) missense probably benign
R4544:Psg26 UTSW 7 18,212,464 (GRCm39) missense probably damaging 1.00
R4977:Psg26 UTSW 7 18,209,235 (GRCm39) missense probably benign 0.11
R5000:Psg26 UTSW 7 18,214,057 (GRCm39) missense possibly damaging 0.95
R5376:Psg26 UTSW 7 18,214,030 (GRCm39) missense probably benign
R5416:Psg26 UTSW 7 18,216,525 (GRCm39) missense probably benign
R5435:Psg26 UTSW 7 18,212,398 (GRCm39) missense possibly damaging 0.60
R6000:Psg26 UTSW 7 18,216,617 (GRCm39) nonsense probably null
R6285:Psg26 UTSW 7 18,216,753 (GRCm39) missense probably benign
R7062:Psg26 UTSW 7 18,216,521 (GRCm39) missense probably damaging 1.00
R7083:Psg26 UTSW 7 18,213,934 (GRCm39) nonsense probably null
R7513:Psg26 UTSW 7 18,209,225 (GRCm39) missense probably benign 0.03
R7817:Psg26 UTSW 7 18,216,572 (GRCm39) missense not run
R7857:Psg26 UTSW 7 18,212,215 (GRCm39) missense possibly damaging 0.71
R8047:Psg26 UTSW 7 18,212,474 (GRCm39) missense possibly damaging 0.50
R8789:Psg26 UTSW 7 18,216,494 (GRCm39) missense probably damaging 1.00
R8877:Psg26 UTSW 7 18,217,865 (GRCm39) missense probably benign 0.01
R9012:Psg26 UTSW 7 18,216,596 (GRCm39) missense probably benign 0.19
R9203:Psg26 UTSW 7 18,212,382 (GRCm39) missense probably damaging 0.98
R9327:Psg26 UTSW 7 18,216,480 (GRCm39) missense probably damaging 1.00
R9547:Psg26 UTSW 7 18,214,087 (GRCm39) missense probably benign 0.00
Z1177:Psg26 UTSW 7 18,214,216 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGACTGGTCTTTGAGCTGAC -3'
(R):5'- TTGGCAAATGCAAAGCACAC -3'

Sequencing Primer
(F):5'- TGAAGGCCTCACATTGGTAC -3'
(R):5'- CACGATATGAGTGTAGTCACAGTTCC -3'
Posted On 2019-12-20