Incidental Mutation 'R7905:Zfp768'
ID610221
Institutional Source Beutler Lab
Gene Symbol Zfp768
Ensembl Gene ENSMUSG00000047371
Gene Namezinc finger protein 768
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127342795-127345589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127344659 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000055374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060783] [ENSMUST00000205266]
Predicted Effect probably damaging
Transcript: ENSMUST00000060783
AA Change: E102G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055374
Gene: ENSMUSG00000047371
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 112 130 3.7e-4 PFAM
Pfam:RNA_pol_Rpb1_R 133 152 1.3e-4 PFAM
low complexity region 271 288 N/A INTRINSIC
ZnF_C2H2 289 311 7.15e-2 SMART
ZnF_C2H2 317 339 1.22e-4 SMART
ZnF_C2H2 345 367 1.5e-4 SMART
ZnF_C2H2 373 395 4.3e-5 SMART
ZnF_C2H2 401 423 4.24e-4 SMART
ZnF_C2H2 429 451 9.58e-3 SMART
ZnF_C2H2 457 479 1.47e-3 SMART
ZnF_C2H2 485 507 7.49e-5 SMART
ZnF_C2H2 513 535 1.03e-2 SMART
ZnF_C2H2 541 563 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205266
AA Change: E99G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Other mutations in Zfp768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp768 APN 7 127344531 missense possibly damaging 0.80
IGL03236:Zfp768 APN 7 127343970 missense possibly damaging 0.93
R1490:Zfp768 UTSW 7 127343631 missense probably damaging 1.00
R1497:Zfp768 UTSW 7 127343561 missense probably damaging 1.00
R2251:Zfp768 UTSW 7 127344378 missense probably benign
R2298:Zfp768 UTSW 7 127344189 missense probably benign 0.11
R2360:Zfp768 UTSW 7 127344638 missense probably benign 0.43
R4751:Zfp768 UTSW 7 127344762 missense possibly damaging 0.94
R4795:Zfp768 UTSW 7 127343375 missense possibly damaging 0.60
R5011:Zfp768 UTSW 7 127343703 missense probably damaging 1.00
R5518:Zfp768 UTSW 7 127344411 missense probably benign
R5602:Zfp768 UTSW 7 127344632 missense possibly damaging 0.73
R5876:Zfp768 UTSW 7 127344546 missense probably benign 0.01
R6245:Zfp768 UTSW 7 127344091 nonsense probably null
R6273:Zfp768 UTSW 7 127345147 critical splice donor site probably null
R6376:Zfp768 UTSW 7 127344720 missense probably benign 0.34
R6475:Zfp768 UTSW 7 127344655 missense probably damaging 0.97
R7125:Zfp768 UTSW 7 127344787 missense probably damaging 0.98
R8781:Zfp768 UTSW 7 127343304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCGGGGCTCTTTGAACC -3'
(R):5'- TGTAATTCTCAGATCCTGCAGGC -3'

Sequencing Primer
(F):5'- AACCGTACCCAGGGCTTTTG -3'
(R):5'- GATCCTGCAGGCAACACAAGTG -3'
Posted On2019-12-20