Mutagenetix > Incidental Mutations

Incidental Mutation 'R7905:Ttc13'

610222

Institutional Source

Beutler Lab

Gene Symbol

Ttc13

Ensembl Gene

ENSMUSG00000037300

Gene Name

tetratricopeptide repeat domain 13

Synonyms

MGC:28881

MMRRC Submission

Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7905 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124671332-124721983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124688596 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 268 (M268K)

Ref Sequence

ENSEMBL: ENSMUSP00000038484 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]

Predicted Effect

probably benign
Transcript: ENSMUST00000041614
AA Change: M268K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: M268K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:TPR_11	153	204	3e-8	PFAM
Pfam:TPR_19	154	213	5.1e-8	PFAM
Pfam:TPR_1	173	206	6.1e-10	PFAM
Pfam:TPR_2	173	206	1.2e-7	PFAM
Pfam:TPR_8	173	206	5.2e-8	PFAM
Pfam:TPR_16	177	241	6.5e-11	PFAM
Pfam:TPR_9	179	249	3.5e-6	PFAM
Pfam:TPR_11	204	272	2.2e-8	PFAM
Pfam:TPR_1	207	240	3.3e-5	PFAM
Pfam:TPR_2	207	240	1.9e-5	PFAM
Blast:UTG	692	755	4e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117624
AA Change: M290K

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: M290K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	161	2e-13	BLAST
TPR	162	194	1.08e1	SMART
TPR	195	228	2.24e-7	SMART
TPR	229	262	3.67e-3	SMART
Blast:UTG	714	777	4e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118134
AA Change: M344K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: M344K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	156	4e-10	BLAST
TPR	181	214	5.56e-3	SMART
TPR	215	248	1.17e-1	SMART
TPR	249	282	2.24e-7	SMART
TPR	283	316	3.67e-3	SMART
Blast:UTG	768	831	1e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000214828
AA Change: M397K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231984
AA Change: M268K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (44/44)

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,296,102	I358T	probably benign	Het
Actl9	T	C	17: 33,433,827	V287A	possibly damaging	Het
Adcy10	T	A	1: 165,513,168		probably null	Het
Aox1	G	A	1: 58,104,398	S1225N	possibly damaging	Het
B430306N03Rik	T	A	17: 48,316,960	S96R	probably benign	Het
Bpifa5	T	C	2: 154,165,588	I150T	probably damaging	Het
Ccdc28a	A	T	10: 18,218,328	V181D	probably benign	Het
Cd40	T	C	2: 165,062,325	Y31H	probably damaging	Het
Cep290	A	G	10: 100,554,490	T2032A	probably benign	Het
Cnbd1	T	C	4: 18,907,100	K158R	possibly damaging	Het
Degs1	A	C	1: 182,279,036	N255K	possibly damaging	Het
Dirc2	G	A	16: 35,768,950	P98S	probably benign	Het
Dll3	T	G	7: 28,301,535	I32L	possibly damaging	Het
Dsg4	A	T	18: 20,454,669	I278F	probably damaging	Het
Ets2	T	A	16: 95,706,437	I6N	probably damaging	Het
Gbp4	A	G	5: 105,121,087	F400S	probably damaging	Het
Golgb1	C	T	16: 36,913,685	A1139V	probably benign	Het
Hfm1	A	T	5: 106,898,553	L489H	probably damaging	Het
Kcna5	T	C	6: 126,534,868	D99G	probably benign	Het
Ldhc	A	G	7: 46,875,531		probably null	Het
Mief1	C	G	15: 80,249,398	P219A	probably damaging	Het
Myh11	A	T	16: 14,207,681	Y1408*	probably null	Het
Myo1b	A	G	1: 51,763,884		probably null	Het
Nedd4	A	T	9: 72,677,379	K121*	probably null	Het
Nek9	A	C	12: 85,305,596	M831R	probably damaging	Het
Nf1	G	A	11: 79,547,112	A83T	possibly damaging	Het
Olfr772	A	T	10: 129,174,187	I278N	probably damaging	Het
Osbpl10	T	C	9: 115,062,010		probably null	Het
Pcdhb6	T	C	18: 37,334,554	L176P	probably benign	Het
Plxnb1	G	A	9: 109,109,232	V1285M	probably damaging	Het
Psg26	T	A	7: 18,475,317	M389L	probably benign	Het
Slc4a10	A	G	2: 62,268,151	E543G	probably damaging	Het
Spink7	G	T	18: 62,592,416	C85*	probably null	Het
Stard9	T	C	2: 120,696,081	W940R	not run	Het
Susd2	A	T	10: 75,639,657	L471*	probably null	Het
Taf2	A	T	15: 55,047,432	D615E	possibly damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tfdp2	T	C	9: 96,310,606	S14P		Het
Tha1	A	C	11: 117,871,067	V116G	possibly damaging	Het
Trim46	T	C	3: 89,244,326	H50R	probably damaging	Het
Trit1	A	G	4: 123,016,715	K36E	probably damaging	Het
Ufc1	T	A	1: 171,289,935	K68N	probably damaging	Het
Zbbx	T	C	3: 75,085,513	T225A	probably benign	Het
Zfp768	T	C	7: 127,344,659	E102G	probably damaging	Het

Other mutations in Ttc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Ttc13	APN	8	124688847	splice site	probably benign
IGL01086:Ttc13	APN	8	124675346	missense	probably damaging	0.98
IGL01411:Ttc13	APN	8	124683285	missense	probably damaging	1.00
IGL01511:Ttc13	APN	8	124676371	missense	probably damaging	1.00
IGL01610:Ttc13	APN	8	124676344	missense	probably damaging	1.00
IGL01626:Ttc13	APN	8	124673738	splice site	probably benign
IGL01967:Ttc13	APN	8	124712647	missense	probably damaging	0.99
IGL01995:Ttc13	APN	8	124688882	missense	probably damaging	1.00
IGL02456:Ttc13	APN	8	124690361	critical splice acceptor site	probably null
IGL02816:Ttc13	APN	8	124712676	missense	possibly damaging	0.89
3-1:Ttc13	UTSW	8	124679009	missense	possibly damaging	0.81
LCD18:Ttc13	UTSW	8	124675866	intron	probably benign
R0126:Ttc13	UTSW	8	124683291	missense	probably damaging	0.99
R0391:Ttc13	UTSW	8	124674401	missense	probably damaging	1.00
R0602:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0629:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0638:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0714:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R1981:Ttc13	UTSW	8	124714187	critical splice donor site	probably null
R2051:Ttc13	UTSW	8	124672211	splice site	probably null
R2324:Ttc13	UTSW	8	124679057	missense	probably damaging	1.00
R2404:Ttc13	UTSW	8	124678997	splice site	probably benign
R2571:Ttc13	UTSW	8	124683799	missense	probably damaging	1.00
R3110:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R3112:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R4560:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4562:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4563:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4565:Ttc13	UTSW	8	124682087	missense	probably damaging	1.00
R4855:Ttc13	UTSW	8	124674435	missense	probably damaging	1.00
R4998:Ttc13	UTSW	8	124680056	missense	probably damaging	1.00
R5137:Ttc13	UTSW	8	124694935	nonsense	probably null
R5397:Ttc13	UTSW	8	124675263	missense	possibly damaging	0.94
R5619:Ttc13	UTSW	8	124679944	intron	probably benign
R5966:Ttc13	UTSW	8	124682220	intron	probably benign
R6092:Ttc13	UTSW	8	124679033	missense	probably benign	0.36
R6321:Ttc13	UTSW	8	124683191	missense	probably damaging	1.00
R6439:Ttc13	UTSW	8	124673482	missense	probably benign	0.02
R6737:Ttc13	UTSW	8	124682161	critical splice acceptor site	probably null
R6804:Ttc13	UTSW	8	124699687	missense	probably damaging	1.00
R6967:Ttc13	UTSW	8	124688618	missense	probably benign	0.17
R7542:Ttc13	UTSW	8	124675103	splice site	probably null
X0027:Ttc13	UTSW	8	124673589	missense	probably benign
Z1176:Ttc13	UTSW	8	124694842	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTCGGAAGACACTGAGGAC -3'
(R):5'- GTGGCACTAACTAACCTGGAAG -3'

Sequencing Primer
(F):5'- AAGACACTGAGGACCCTGGTC -3'
(R):5'- CTAACTAACCTGGAAGGGGTGCC -3'

Posted On

2019-12-20