Incidental Mutation 'R7905:Osbpl10'
ID610226
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7905 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 115062010 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000182920] [ENSMUST00000183104] [ENSMUST00000183141]
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182384
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182920
Predicted Effect probably null
Transcript: ENSMUST00000183104
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183141
SMART Domains Protein: ENSMUSP00000138760
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 3e-18 BLAST
PDB:2D9X|A 2 46 6e-8 PDB
SCOP:d1ki1b2 10 42 9e-4 SMART
low complexity region 131 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R0948:Osbpl10 UTSW 9 115167119 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4406:Osbpl10 UTSW 9 115109481 missense probably damaging 0.96
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 unclassified probably null
R6103:Osbpl10 UTSW 9 115061872 nonsense probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7008:Osbpl10 UTSW 9 115061848 missense probably damaging 1.00
R7027:Osbpl10 UTSW 9 115223698 missense probably damaging 0.97
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7936:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7988:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGAGAAGTCATGTGCTGTCTTTC -3'
(R):5'- TGTTCTTCAGATTCCCAAGTGG -3'

Sequencing Primer
(F):5'- AGAAGTCATGTGCTGTCTTTCTGTTC -3'
(R):5'- GTGTACATGTGTTCACCAATGC -3'
Posted On2019-12-20