Incidental Mutation 'R7905:4932415D10Rik'
ID610229
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82296102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 358 (I358T)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: I358T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
R7875:4932415D10Rik UTSW 10 82287622 missense possibly damaging 0.79
R7878:4932415D10Rik UTSW 10 82284022 missense probably benign 0.04
R7899:4932415D10Rik UTSW 10 82282897 missense unknown
R7975:4932415D10Rik UTSW 10 82283989 missense possibly damaging 0.95
R7988:4932415D10Rik UTSW 10 82296100 missense probably benign 0.03
R8076:4932415D10Rik UTSW 10 82296686 nonsense probably null
R8144:4932415D10Rik UTSW 10 82294599 nonsense probably null
R8429:4932415D10Rik UTSW 10 82289467 missense possibly damaging 0.62
R8465:4932415D10Rik UTSW 10 82316464 missense possibly damaging 0.52
R8470:4932415D10Rik UTSW 10 82290480 missense probably damaging 1.00
R8509:4932415D10Rik UTSW 10 82291116 missense probably benign 0.01
R8515:4932415D10Rik UTSW 10 82288602 missense probably benign 0.00
R8672:4932415D10Rik UTSW 10 82291892 missense probably benign 0.01
R8700:4932415D10Rik UTSW 10 82292025 missense possibly damaging 0.84
R8827:4932415D10Rik UTSW 10 82293783 missense probably benign 0.07
R8872:4932415D10Rik UTSW 10 82292785 missense probably benign 0.07
R8875:4932415D10Rik UTSW 10 82287642 missense probably benign 0.16
R8884:4932415D10Rik UTSW 10 82283652 missense probably damaging 0.96
R8906:4932415D10Rik UTSW 10 82286545 missense probably benign 0.02
R8924:4932415D10Rik UTSW 10 82295461 missense probably benign 0.03
R8949:4932415D10Rik UTSW 10 82287919 missense probably benign 0.00
R8957:4932415D10Rik UTSW 10 82289074 missense probably benign 0.07
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Z1176:4932415D10Rik UTSW 10 82282537 missense unknown
Z1176:4932415D10Rik UTSW 10 82289896 missense possibly damaging 0.94
Z1176:4932415D10Rik UTSW 10 82293228 missense probably benign 0.03
Z1177:4932415D10Rik UTSW 10 82285798 missense possibly damaging 0.46
Z1177:4932415D10Rik UTSW 10 82287126 missense possibly damaging 0.85
Z1177:4932415D10Rik UTSW 10 82287417 missense probably damaging 0.99
Z1177:4932415D10Rik UTSW 10 82289686 nonsense probably null
Z1187:4932415D10Rik UTSW 10 82288556 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAACAGTGCTACAGGGATTACTTTGG -3'
(R):5'- AGACCCAAAGCATGTGTTAAAGC -3'

Sequencing Primer
(F):5'- GCTACAGGGATTACTTTGGAGATATC -3'
(R):5'- CCAAAGCATGTGTTAAAGCTGAATAC -3'
Posted On2019-12-20