Incidental Mutation 'R7905:Cep290'
ID 610230
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 045957-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R7905 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100390352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2032 (T2032A)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: T2032A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: T2032A

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: T2025A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: T2032A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,801 (GRCm39) V287A possibly damaging Het
Adcy10 T A 1: 165,340,737 (GRCm39) probably null Het
Aox1 G A 1: 58,143,557 (GRCm39) S1225N possibly damaging Het
B430306N03Rik T A 17: 48,623,988 (GRCm39) S96R probably benign Het
Bpifa5 T C 2: 154,007,508 (GRCm39) I150T probably damaging Het
Ccdc28a A T 10: 18,094,076 (GRCm39) V181D probably benign Het
Cd40 T C 2: 164,904,245 (GRCm39) Y31H probably damaging Het
Cnbd1 T C 4: 18,907,100 (GRCm39) K158R possibly damaging Het
Degs1 A C 1: 182,106,601 (GRCm39) N255K possibly damaging Het
Dll3 T G 7: 28,000,960 (GRCm39) I32L possibly damaging Het
Dsg4 A T 18: 20,587,726 (GRCm39) I278F probably damaging Het
Ets2 T A 16: 95,507,304 (GRCm39) I6N probably damaging Het
Gbp4 A G 5: 105,268,953 (GRCm39) F400S probably damaging Het
Golgb1 C T 16: 36,734,047 (GRCm39) A1139V probably benign Het
Hfm1 A T 5: 107,046,419 (GRCm39) L489H probably damaging Het
Kcna5 T C 6: 126,511,831 (GRCm39) D99G probably benign Het
Ldhc A G 7: 46,524,955 (GRCm39) probably null Het
Mief1 C G 15: 80,133,599 (GRCm39) P219A probably damaging Het
Myh11 A T 16: 14,025,545 (GRCm39) Y1408* probably null Het
Myo1b A G 1: 51,803,043 (GRCm39) probably null Het
Nedd4 A T 9: 72,584,661 (GRCm39) K121* probably null Het
Nek9 A C 12: 85,352,370 (GRCm39) M831R probably damaging Het
Nf1 G A 11: 79,437,938 (GRCm39) A83T possibly damaging Het
Or6c203 A T 10: 129,010,056 (GRCm39) I278N probably damaging Het
Osbpl10 T C 9: 114,891,078 (GRCm39) probably null Het
Pcdhb6 T C 18: 37,467,607 (GRCm39) L176P probably benign Het
Plxnb1 G A 9: 108,938,300 (GRCm39) V1285M probably damaging Het
Psg26 T A 7: 18,209,242 (GRCm39) M389L probably benign Het
Slc49a4 G A 16: 35,589,320 (GRCm39) P98S probably benign Het
Slc4a10 A G 2: 62,098,495 (GRCm39) E543G probably damaging Het
Spata31h1 A G 10: 82,131,936 (GRCm39) I358T probably benign Het
Spink7 G T 18: 62,725,487 (GRCm39) C85* probably null Het
Stard9 T C 2: 120,526,562 (GRCm39) W940R not run Het
Susd2 A T 10: 75,475,491 (GRCm39) L471* probably null Het
Taf2 A T 15: 54,910,828 (GRCm39) D615E possibly damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tfdp2 T C 9: 96,192,659 (GRCm39) S14P Het
Tha1 A C 11: 117,761,893 (GRCm39) V116G possibly damaging Het
Trim46 T C 3: 89,151,633 (GRCm39) H50R probably damaging Het
Trit1 A G 4: 122,910,508 (GRCm39) K36E probably damaging Het
Ttc13 A T 8: 125,415,335 (GRCm39) M268K probably benign Het
Ufc1 T A 1: 171,117,508 (GRCm39) K68N probably damaging Het
Zbbx T C 3: 74,992,820 (GRCm39) T225A probably benign Het
Zfp768 T C 7: 126,943,831 (GRCm39) E102G probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTTTTGTAGAAGCCTGAGAG -3'
(R):5'- TGTCCTATCAGACAGGATCAGAG -3'

Sequencing Primer
(F):5'- CTTTTGTAGAAGCCTGAGAGTAAAG -3'
(R):5'- TCCTATCAGACAGGATCAGAGAAATG -3'
Posted On 2019-12-20