Incidental Mutation 'R7905:Olfr772'
ID610231
Institutional Source Beutler Lab
Gene Symbol Olfr772
Ensembl Gene ENSMUSG00000107662
Gene Nameolfactory receptor 772
SynonymsMOR114-3, GA_x6K02T2PULF-10860457-10859522
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129172573-129177921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129174187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 278 (I278N)
Ref Sequence ENSEMBL: ENSMUSP00000148854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169800] [ENSMUST00000214672]
Predicted Effect probably damaging
Transcript: ENSMUST00000169800
AA Change: I278N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132389
Gene: ENSMUSG00000107662
AA Change: I278N

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.6e-47 PFAM
Pfam:7tm_1 38 287 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214672
AA Change: I278N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Olfr772
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02512:Olfr772 APN 10 129174250 missense possibly damaging 0.65
IGL03072:Olfr772 APN 10 129174489 missense probably damaging 1.00
IGL03336:Olfr772 APN 10 129174229 missense probably benign 0.00
R1852:Olfr772 UTSW 10 129174328 missense probably benign 0.00
R2496:Olfr772 UTSW 10 129174097 missense probably benign 0.00
R6031:Olfr772 UTSW 10 129174355 missense probably benign 0.14
R6031:Olfr772 UTSW 10 129174355 missense probably benign 0.14
R6168:Olfr772 UTSW 10 129174166 missense probably damaging 1.00
R7454:Olfr772 UTSW 10 129174455 missense probably damaging 1.00
R7669:Olfr772 UTSW 10 129174259 missense probably damaging 1.00
R8307:Olfr772 UTSW 10 129174232 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGAAAGTCAGTCGACCAC -3'
(R):5'- CACTCATTATAACGCTGGTGTGTG -3'

Sequencing Primer
(F):5'- TCGACCACAAAGAGAAAGAGTGTTC -3'
(R):5'- ATCATCAAGACAGTTCTTAGATTCCC -3'
Posted On2019-12-20