Incidental Mutation 'R7905:Mief1'
ID610236
Institutional Source Beutler Lab
Gene Symbol Mief1
Ensembl Gene ENSMUSG00000022412
Gene Namemitochondrial elongation factor 1
SynonymsSmcr7l
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7905 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80234018-80253371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80249398 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 219 (P219A)
Ref Sequence ENSEMBL: ENSMUSP00000023048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023048] [ENSMUST00000166030] [ENSMUST00000228788] [ENSMUST00000229138]
PDB Structure
Crystal structure of the cytosolic domain of mouse MiD51 [X-RAY DIFFRACTION]
Crystal structure of the cytosolic domain of mouse MiD51 bound to ADP [X-RAY DIFFRACTION]
Crystal structure of the cytosolic domain of mouse MiD51 H201A mutant [X-RAY DIFFRACTION]
Crystal structure of the cytosolic domain of mouse MiD51 dimer mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023048
AA Change: P219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023048
Gene: ENSMUSG00000022412
AA Change: P219A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Mab-21 189 455 7.09e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166030
AA Change: P219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129209
Gene: ENSMUSG00000022412
AA Change: P219A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Mab-21 189 455 7.09e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228788
Predicted Effect probably damaging
Transcript: ENSMUST00000229138
AA Change: P219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3609 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Mief1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Mief1 APN 15 80248508 splice site probably benign
R1754:Mief1 UTSW 15 80249602 missense probably damaging 0.97
R2010:Mief1 UTSW 15 80247925 missense possibly damaging 0.95
R4379:Mief1 UTSW 15 80247959 missense possibly damaging 0.86
R4609:Mief1 UTSW 15 80248253 missense probably benign 0.12
R4789:Mief1 UTSW 15 80247879 nonsense probably null
R5862:Mief1 UTSW 15 80248385 missense probably benign 0.01
R6101:Mief1 UTSW 15 80249740 missense probably benign 0.00
R6350:Mief1 UTSW 15 80249603 missense probably damaging 1.00
R6605:Mief1 UTSW 15 80248491 nonsense probably null
R6944:Mief1 UTSW 15 80249443 missense probably damaging 1.00
R7197:Mief1 UTSW 15 80249860 missense possibly damaging 0.94
R7316:Mief1 UTSW 15 80249397 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGTAAAGCCCTTTAAAACCTTC -3'
(R):5'- TCTAAGAGGGACCCTATGGCTG -3'

Sequencing Primer
(F):5'- AAACCTTCTAATTCTGGGGCCAG -3'
(R):5'- TGGCTGGCCAGTTGATG -3'
Posted On2019-12-20