Incidental Mutation 'R7905:Pcdhb6'
ID 610244
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Name protocadherin beta 6
Synonyms Pcdhb5B, PcdhbF
MMRRC Submission 045957-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7905 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37466913-37470491 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37467607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 176 (L176P)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
AlphaFold Q91XZ4
Predicted Effect probably benign
Transcript: ENSMUST00000061717
AA Change: L176P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: L176P

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,801 (GRCm39) V287A possibly damaging Het
Adcy10 T A 1: 165,340,737 (GRCm39) probably null Het
Aox1 G A 1: 58,143,557 (GRCm39) S1225N possibly damaging Het
B430306N03Rik T A 17: 48,623,988 (GRCm39) S96R probably benign Het
Bpifa5 T C 2: 154,007,508 (GRCm39) I150T probably damaging Het
Ccdc28a A T 10: 18,094,076 (GRCm39) V181D probably benign Het
Cd40 T C 2: 164,904,245 (GRCm39) Y31H probably damaging Het
Cep290 A G 10: 100,390,352 (GRCm39) T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 (GRCm39) K158R possibly damaging Het
Degs1 A C 1: 182,106,601 (GRCm39) N255K possibly damaging Het
Dll3 T G 7: 28,000,960 (GRCm39) I32L possibly damaging Het
Dsg4 A T 18: 20,587,726 (GRCm39) I278F probably damaging Het
Ets2 T A 16: 95,507,304 (GRCm39) I6N probably damaging Het
Gbp4 A G 5: 105,268,953 (GRCm39) F400S probably damaging Het
Golgb1 C T 16: 36,734,047 (GRCm39) A1139V probably benign Het
Hfm1 A T 5: 107,046,419 (GRCm39) L489H probably damaging Het
Kcna5 T C 6: 126,511,831 (GRCm39) D99G probably benign Het
Ldhc A G 7: 46,524,955 (GRCm39) probably null Het
Mief1 C G 15: 80,133,599 (GRCm39) P219A probably damaging Het
Myh11 A T 16: 14,025,545 (GRCm39) Y1408* probably null Het
Myo1b A G 1: 51,803,043 (GRCm39) probably null Het
Nedd4 A T 9: 72,584,661 (GRCm39) K121* probably null Het
Nek9 A C 12: 85,352,370 (GRCm39) M831R probably damaging Het
Nf1 G A 11: 79,437,938 (GRCm39) A83T possibly damaging Het
Or6c203 A T 10: 129,010,056 (GRCm39) I278N probably damaging Het
Osbpl10 T C 9: 114,891,078 (GRCm39) probably null Het
Plxnb1 G A 9: 108,938,300 (GRCm39) V1285M probably damaging Het
Psg26 T A 7: 18,209,242 (GRCm39) M389L probably benign Het
Slc49a4 G A 16: 35,589,320 (GRCm39) P98S probably benign Het
Slc4a10 A G 2: 62,098,495 (GRCm39) E543G probably damaging Het
Spata31h1 A G 10: 82,131,936 (GRCm39) I358T probably benign Het
Spink7 G T 18: 62,725,487 (GRCm39) C85* probably null Het
Stard9 T C 2: 120,526,562 (GRCm39) W940R not run Het
Susd2 A T 10: 75,475,491 (GRCm39) L471* probably null Het
Taf2 A T 15: 54,910,828 (GRCm39) D615E possibly damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tfdp2 T C 9: 96,192,659 (GRCm39) S14P Het
Tha1 A C 11: 117,761,893 (GRCm39) V116G possibly damaging Het
Trim46 T C 3: 89,151,633 (GRCm39) H50R probably damaging Het
Trit1 A G 4: 122,910,508 (GRCm39) K36E probably damaging Het
Ttc13 A T 8: 125,415,335 (GRCm39) M268K probably benign Het
Ufc1 T A 1: 171,117,508 (GRCm39) K68N probably damaging Het
Zbbx T C 3: 74,992,820 (GRCm39) T225A probably benign Het
Zfp768 T C 7: 126,943,831 (GRCm39) E102G probably damaging Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37,467,277 (GRCm39) missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37,468,873 (GRCm39) missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37,468,735 (GRCm39) missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37,468,507 (GRCm39) missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37,467,747 (GRCm39) missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37,468,640 (GRCm39) nonsense probably null
IGL03144:Pcdhb6 APN 18 37,467,459 (GRCm39) missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37,469,205 (GRCm39) missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37,467,585 (GRCm39) missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37,469,190 (GRCm39) missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37,468,300 (GRCm39) missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37,468,167 (GRCm39) missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37,468,387 (GRCm39) missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37,467,640 (GRCm39) missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37,468,633 (GRCm39) missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37,469,284 (GRCm39) missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37,468,222 (GRCm39) missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37,468,945 (GRCm39) missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37,469,193 (GRCm39) missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37,469,259 (GRCm39) missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37,468,426 (GRCm39) missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37,467,381 (GRCm39) missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37,467,388 (GRCm39) missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37,467,783 (GRCm39) missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37,467,402 (GRCm39) missense probably benign
R5556:Pcdhb6 UTSW 18 37,467,442 (GRCm39) missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37,467,753 (GRCm39) missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37,467,966 (GRCm39) missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37,468,978 (GRCm39) missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37,468,974 (GRCm39) nonsense probably null
R6528:Pcdhb6 UTSW 18 37,467,556 (GRCm39) missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37,468,198 (GRCm39) missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37,469,329 (GRCm39) missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37,468,531 (GRCm39) missense probably benign
R7313:Pcdhb6 UTSW 18 37,468,261 (GRCm39) missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37,468,225 (GRCm39) missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37,468,332 (GRCm39) missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37,468,659 (GRCm39) missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37,467,562 (GRCm39) missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37,469,365 (GRCm39) missense probably benign 0.05
R7982:Pcdhb6 UTSW 18 37,467,273 (GRCm39) nonsense probably null
R8818:Pcdhb6 UTSW 18 37,468,837 (GRCm39) missense probably benign 0.06
R8917:Pcdhb6 UTSW 18 37,468,431 (GRCm39) missense possibly damaging 0.92
R9397:Pcdhb6 UTSW 18 37,469,353 (GRCm39) missense probably benign 0.00
Z1088:Pcdhb6 UTSW 18 37,468,199 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTGCACTTCCAGATC -3'
(R):5'- GATGTCCACGACTTCAATTCGAAC -3'

Sequencing Primer
(F):5'- GTGCTGCACTTCCAGATCATACTAG -3'
(R):5'- TCAATTCGAACAGTGGTAGTCCCAG -3'
Posted On 2019-12-20