Mutagenetix > Incidental Mutation

Incidental Mutation 'R7908:Zdbf2'

610247

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R7908 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63306827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1455 (I1455T)

Ref Sequence

ENSEMBL: ENSMUSP00000029025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: I1455T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: I1455T

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: I1455T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: I1455T

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	T	12: 55,379,465	K533N	possibly damaging	Het
1110032A03Rik	T	A	9: 50,763,948	T153S	possibly damaging	Het
9530053A07Rik	A	T	7: 28,147,496	Y1168F	probably benign	Het
A4galt	A	G	15: 83,228,376	F69L	probably benign	Het
Acsf3	A	G	8: 122,785,823	M328V	probably damaging	Het
Adam10	T	G	9: 70,761,764	V454G	possibly damaging	Het
Adamts15	T	C	9: 30,902,226	D881G	probably benign	Het
Adamtsl1	T	C	4: 86,356,439	V1244A	probably benign	Het
Ankfn1	G	A	11: 89,405,534	P123L	probably damaging	Het
Aox1	T	C	1: 58,106,068	I1331T	possibly damaging	Het
Arntl	A	T	7: 113,313,473	I579L	probably benign	Het
Atg14	T	A	14: 47,568,593		probably benign	Het
Btnl4	A	G	17: 34,473,187	M147T	possibly damaging	Het
Camk1g	T	C	1: 193,359,774	K56E	probably damaging	Het
Capn7	T	C	14: 31,366,245		probably null	Het
Cbln1	T	A	8: 87,472,096	T49S	probably benign	Het
Cc2d2a	T	C	5: 43,706,846	V763A	probably benign	Het
Cdc40	A	G	10: 40,848,046	Y249H	probably damaging	Het
Cfap61	T	A	2: 146,102,099	L762H	probably damaging	Het
Cfap73	T	C	5: 120,630,058	T212A	probably benign	Het
Cfi	A	G	3: 129,848,584	E29G	probably benign	Het
Chmp6	A	T	11: 119,913,830		probably benign	Het
Clec14a	T	C	12: 58,267,679	T386A	possibly damaging	Het
Coq6	T	A	12: 84,371,166	L268H	probably damaging	Het
Cpt1a	T	C	19: 3,362,202	S225P	probably benign	Het
Dhx58	C	A	11: 100,695,304	L630F	probably damaging	Het
Dlg2	T	A	7: 91,900,773	V158E	probably damaging	Het
Foxd3	A	G	4: 99,657,339	T239A	probably benign	Het
Galnt6	T	C	15: 100,703,361	T346A	probably damaging	Het
Guca1b	C	G	17: 47,391,177	T185S	unknown	Het
H2-M5	T	C	17: 36,987,679	T292A	probably benign	Het
Hlx	T	C	1: 184,727,576	H455R	probably benign	Het
Hydin	A	G	8: 110,510,867	Y1924C	probably benign	Het
Ighg2b	C	T	12: 113,306,454	V315M		Het
Ildr2	A	G	1: 166,307,800	K374E	probably damaging	Het
Jmjd1c	T	C	10: 67,225,842	S1144P	probably benign	Het
Kcnj8	T	C	6: 142,566,029	D284G	probably benign	Het
Kri1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCCTCCTCCTC	9: 21,281,056		probably benign	Het
Lingo4	A	G	3: 94,402,234	T160A	probably benign	Het
Lmod3	G	T	6: 97,248,473	A129E	probably benign	Het
Lrrk2	T	C	15: 91,726,152	C696R	probably damaging	Het
Mc2r	A	G	18: 68,407,965	F86L	probably benign	Het
Mfsd7a	T	C	5: 108,444,497	I276V	probably benign	Het
Mppe1	T	G	18: 67,228,984	K170T	probably benign	Het
Mtcl1	A	G	17: 66,371,330	I667T	possibly damaging	Het
Mtnr1a	A	T	8: 45,087,826	I275F	probably benign	Het
Myh2	A	G	11: 67,197,371	I1938V	probably benign	Het
Npsr1	A	T	9: 24,289,800	E160V	probably damaging	Het
Olfr156	T	A	4: 43,821,086	I92F	probably damaging	Het
Olfr205	C	T	16: 59,329,243	D89N	possibly damaging	Het
Olfr788	T	A	10: 129,472,998	I102N	probably damaging	Het
Ovch2	T	A	7: 107,789,119	Y418F	probably damaging	Het
Pak7	A	G	2: 136,116,559	L203S	probably benign	Het
Pcdh15	A	T	10: 74,643,582	E508D	probably benign	Het
Prl7a1	T	C	13: 27,642,450	M1V	probably null	Het
Prpsap2	G	T	11: 61,756,272	N14K	possibly damaging	Het
Rad54b	T	A	4: 11,595,868	V215E	probably null	Het
Ryr2	G	A	13: 11,792,748	T845I	probably benign	Het
Scgb2b3	G	A	7: 31,362,014	T20I	probably damaging	Het
Serpina1b	T	C	12: 103,728,307	I393V	possibly damaging	Het
Slc13a5	T	C	11: 72,259,064	M207V	probably benign	Het
Smg1	A	T	7: 118,186,134	L843M	unknown	Het
Sp100	T	C	1: 85,708,067	V531A	possibly damaging	Het
Srsf6	T	C	2: 162,933,840	S190P	unknown	Het
Stil	A	G	4: 115,032,699	K795E	possibly damaging	Het
Sugp2	A	G	8: 70,251,927	R705G	probably benign	Het
Tnfrsf11a	T	A	1: 105,809,374	C69S	probably damaging	Het
Trim30a	A	T	7: 104,421,449	N252K	probably benign	Het
Tshz1	T	A	18: 84,014,607	K559*	probably null	Het
Ttbk1	C	T	17: 46,478,938	R133H	probably damaging	Het
Vmn1r1	T	C	1: 182,157,350	Y250C	probably benign	Het
Vmn2r12	A	G	5: 109,086,441	L635P	probably damaging	Het
Vmn2r52	C	A	7: 10,162,950	V532L	probably benign	Het
Vwa5b1	A	T	4: 138,569,170	L1182*	probably null	Het
Washc2	A	G	6: 116,248,145	D818G	probably benign	Het
Xylb	T	G	9: 119,381,545	S365A	probably benign	Het
Zcchc8	T	C	5: 123,720,720		probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTGTGATGGTCCTGAAGTGAG -3'
(R):5'- CACAAGTTACACTGCCCTTGTC -3'

Sequencing Primer
(F):5'- TCTAATGATCCCTGTCAGTCAGTAG -3'
(R):5'- GCCCTTGTCTTCTATGTCAAGCG -3'

Posted On

2019-12-20