Incidental Mutation 'R7908:Cfi'
ID610258
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7908 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129848584 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect probably benign
Transcript: ENSMUST00000077918
AA Change: E29G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: E29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
AA Change: E29G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952
AA Change: E29G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,379,465 K533N possibly damaging Het
1110032A03Rik T A 9: 50,763,948 T153S possibly damaging Het
9530053A07Rik A T 7: 28,147,496 Y1168F probably benign Het
A4galt A G 15: 83,228,376 F69L probably benign Het
Acsf3 A G 8: 122,785,823 M328V probably damaging Het
Adam10 T G 9: 70,761,764 V454G possibly damaging Het
Adamts15 T C 9: 30,902,226 D881G probably benign Het
Adamtsl1 T C 4: 86,356,439 V1244A probably benign Het
Ankfn1 G A 11: 89,405,534 P123L probably damaging Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Arntl A T 7: 113,313,473 I579L probably benign Het
Atg14 T A 14: 47,568,593 probably benign Het
Btnl4 A G 17: 34,473,187 M147T possibly damaging Het
Camk1g T C 1: 193,359,774 K56E probably damaging Het
Capn7 T C 14: 31,366,245 probably null Het
Cbln1 T A 8: 87,472,096 T49S probably benign Het
Cc2d2a T C 5: 43,706,846 V763A probably benign Het
Cdc40 A G 10: 40,848,046 Y249H probably damaging Het
Cfap61 T A 2: 146,102,099 L762H probably damaging Het
Cfap73 T C 5: 120,630,058 T212A probably benign Het
Chmp6 A T 11: 119,913,830 probably benign Het
Clec14a T C 12: 58,267,679 T386A possibly damaging Het
Coq6 T A 12: 84,371,166 L268H probably damaging Het
Cpt1a T C 19: 3,362,202 S225P probably benign Het
Dhx58 C A 11: 100,695,304 L630F probably damaging Het
Dlg2 T A 7: 91,900,773 V158E probably damaging Het
Foxd3 A G 4: 99,657,339 T239A probably benign Het
Galnt6 T C 15: 100,703,361 T346A probably damaging Het
Guca1b C G 17: 47,391,177 T185S unknown Het
H2-M5 T C 17: 36,987,679 T292A probably benign Het
Hlx T C 1: 184,727,576 H455R probably benign Het
Hydin A G 8: 110,510,867 Y1924C probably benign Het
Ighg2b C T 12: 113,306,454 V315M Het
Ildr2 A G 1: 166,307,800 K374E probably damaging Het
Jmjd1c T C 10: 67,225,842 S1144P probably benign Het
Kcnj8 T C 6: 142,566,029 D284G probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Lingo4 A G 3: 94,402,234 T160A probably benign Het
Lmod3 G T 6: 97,248,473 A129E probably benign Het
Lrrk2 T C 15: 91,726,152 C696R probably damaging Het
Mc2r A G 18: 68,407,965 F86L probably benign Het
Mfsd7a T C 5: 108,444,497 I276V probably benign Het
Mppe1 T G 18: 67,228,984 K170T probably benign Het
Mtcl1 A G 17: 66,371,330 I667T possibly damaging Het
Mtnr1a A T 8: 45,087,826 I275F probably benign Het
Myh2 A G 11: 67,197,371 I1938V probably benign Het
Npsr1 A T 9: 24,289,800 E160V probably damaging Het
Olfr156 T A 4: 43,821,086 I92F probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr788 T A 10: 129,472,998 I102N probably damaging Het
Ovch2 T A 7: 107,789,119 Y418F probably damaging Het
Pak7 A G 2: 136,116,559 L203S probably benign Het
Pcdh15 A T 10: 74,643,582 E508D probably benign Het
Prl7a1 T C 13: 27,642,450 M1V probably null Het
Prpsap2 G T 11: 61,756,272 N14K possibly damaging Het
Rad54b T A 4: 11,595,868 V215E probably null Het
Ryr2 G A 13: 11,792,748 T845I probably benign Het
Scgb2b3 G A 7: 31,362,014 T20I probably damaging Het
Serpina1b T C 12: 103,728,307 I393V possibly damaging Het
Slc13a5 T C 11: 72,259,064 M207V probably benign Het
Smg1 A T 7: 118,186,134 L843M unknown Het
Sp100 T C 1: 85,708,067 V531A possibly damaging Het
Srsf6 T C 2: 162,933,840 S190P unknown Het
Stil A G 4: 115,032,699 K795E possibly damaging Het
Sugp2 A G 8: 70,251,927 R705G probably benign Het
Tnfrsf11a T A 1: 105,809,374 C69S probably damaging Het
Trim30a A T 7: 104,421,449 N252K probably benign Het
Tshz1 T A 18: 84,014,607 K559* probably null Het
Ttbk1 C T 17: 46,478,938 R133H probably damaging Het
Vmn1r1 T C 1: 182,157,350 Y250C probably benign Het
Vmn2r12 A G 5: 109,086,441 L635P probably damaging Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vwa5b1 A T 4: 138,569,170 L1182* probably null Het
Washc2 A G 6: 116,248,145 D818G probably benign Het
Xylb T G 9: 119,381,545 S365A probably benign Het
Zcchc8 T C 5: 123,720,720 probably benign Het
Zdbf2 T C 1: 63,306,827 I1455T possibly damaging Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGTGCCGATGAGAACACTC -3'
(R):5'- GGGTAGCTCCTTCCATTCATGG -3'

Sequencing Primer
(F):5'- TGAGAACACTCACGTTCCATGAGG -3'
(R):5'- TGGCACACACTGGGGTGC -3'
Posted On2019-12-20