Incidental Mutation 'R0682:Asic2'
ID61027
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
MMRRC Submission 038867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0682 (G1)
Quality Score85
Status Not validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80886680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 402 (I402V)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021045] [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000021045
AA Change: I453V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021045
Gene: ENSMUSG00000020704
AA Change: I453V

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
Pfam:ASC 61 504 6.7e-94 PFAM
low complexity region 507 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066197
AA Change: I402V

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: I402V

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,840 H83R probably benign Het
Abcd3 A C 3: 121,769,567 I471S possibly damaging Het
Abcg1 G A 17: 31,111,251 V509I probably benign Het
Adamts9 A T 6: 92,903,802 N497K possibly damaging Het
Agap2 A G 10: 127,083,482 S479G unknown Het
Atp1a2 G A 1: 172,284,597 T577I probably benign Het
Atraid T A 5: 31,052,268 I92K probably damaging Het
Dpp10 C A 1: 123,905,125 A31S probably damaging Het
Erich6 A T 3: 58,636,811 F118L probably benign Het
Galnt18 T C 7: 111,520,015 Y418C probably damaging Het
Herc1 T A 9: 66,481,981 C3927S possibly damaging Het
Ifit2 G A 19: 34,573,612 R184H probably benign Het
Kif24 A T 4: 41,428,620 N113K probably benign Het
Lrp1b T A 2: 41,295,641 Y1354F probably benign Het
Muc1 T A 3: 89,231,132 I427N probably damaging Het
Muc5ac A G 7: 141,805,669 T1288A possibly damaging Het
Olfr1499 C T 19: 13,815,137 C151Y possibly damaging Het
Olfr850 C A 9: 19,477,349 M300I probably benign Het
Pex26 T A 6: 121,184,404 V47E probably damaging Het
Plekhm2 T C 4: 141,628,125 I871V probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Rnf133 A T 6: 23,649,570 I163N probably damaging Het
Rrp8 A C 7: 105,734,011 D349E probably damaging Het
Sdhd G T 9: 50,600,605 Q38K probably benign Het
Ssh1 C T 5: 113,960,657 S117N probably damaging Het
Tbc1d2b A G 9: 90,249,862 M148T probably benign Het
Tnni3k A G 3: 154,940,028 S470P probably damaging Het
Tnr C T 1: 159,852,307 Q284* probably null Het
Trim30a A C 7: 104,429,182 V229G probably damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Uck2 T C 1: 167,236,690 D90G probably damaging Het
Vmn1r229 A T 17: 20,814,688 E65V probably benign Het
Vmn2r26 A G 6: 124,061,170 E568G probably damaging Het
Whamm A G 7: 81,586,138 E363G probably damaging Het
Wrap53 A G 11: 69,562,446 S390P probably damaging Het
Wrn A G 8: 33,267,820 S814P probably benign Het
Zfp329 A G 7: 12,810,284 C438R probably damaging Het
Zkscan8 T C 13: 21,526,760 Y60C probably damaging Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5056:Asic2 UTSW 11 80971603 missense possibly damaging 0.64
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5490:Asic2 UTSW 11 80889820 missense probably benign 0.02
R5722:Asic2 UTSW 11 81967980 missense probably benign 0.07
R6072:Asic2 UTSW 11 80894088 missense probably damaging 0.97
R6589:Asic2 UTSW 11 80886604 missense possibly damaging 0.79
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
R7593:Asic2 UTSW 11 81967831 missense probably benign 0.01
R7869:Asic2 UTSW 11 81967998 missense probably damaging 1.00
R7952:Asic2 UTSW 11 81967998 missense probably damaging 1.00
Z1176:Asic2 UTSW 11 80889832 missense not run
Z1176:Asic2 UTSW 11 81967670 missense not run
Z1177:Asic2 UTSW 11 80894011 missense not run
Z1177:Asic2 UTSW 11 81152090 missense not run
Z1177:Asic2 UTSW 11 81152240 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGAGGCTAACTCCAACCTAGAC -3'
(R):5'- GGCTGGGCTTGCAGAAAGAATACC -3'

Sequencing Primer
(F):5'- acacagaggaggcgaaaac -3'
(R):5'- CTTGCAGAAAGAATACCAAGGG -3'
Posted On2013-07-30