Incidental Mutation 'R7908:Olfr788'
ID610295
Institutional Source Beutler Lab
Gene Symbol Olfr788
Ensembl Gene ENSMUSG00000049217
Gene Nameolfactory receptor 788
SynonymsMOR111-4, GA_x6K02T2PULF-11151514-11152449
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7908 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129470998-129476618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129472998 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000151054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056961] [ENSMUST00000213222]
Predicted Effect probably damaging
Transcript: ENSMUST00000056961
AA Change: I102N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054710
Gene: ENSMUSG00000049217
AA Change: I102N

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-49 PFAM
Pfam:7tm_1 38 287 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213222
AA Change: I102N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,379,465 K533N possibly damaging Het
1110032A03Rik T A 9: 50,763,948 T153S possibly damaging Het
9530053A07Rik A T 7: 28,147,496 Y1168F probably benign Het
A4galt A G 15: 83,228,376 F69L probably benign Het
Acsf3 A G 8: 122,785,823 M328V probably damaging Het
Adam10 T G 9: 70,761,764 V454G possibly damaging Het
Adamts15 T C 9: 30,902,226 D881G probably benign Het
Adamtsl1 T C 4: 86,356,439 V1244A probably benign Het
Ankfn1 G A 11: 89,405,534 P123L probably damaging Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Arntl A T 7: 113,313,473 I579L probably benign Het
Atg14 T A 14: 47,568,593 probably benign Het
Btnl4 A G 17: 34,473,187 M147T possibly damaging Het
Camk1g T C 1: 193,359,774 K56E probably damaging Het
Capn7 T C 14: 31,366,245 probably null Het
Cbln1 T A 8: 87,472,096 T49S probably benign Het
Cc2d2a T C 5: 43,706,846 V763A probably benign Het
Cdc40 A G 10: 40,848,046 Y249H probably damaging Het
Cfap61 T A 2: 146,102,099 L762H probably damaging Het
Cfap73 T C 5: 120,630,058 T212A probably benign Het
Cfi A G 3: 129,848,584 E29G probably benign Het
Chmp6 A T 11: 119,913,830 probably benign Het
Clec14a T C 12: 58,267,679 T386A possibly damaging Het
Coq6 T A 12: 84,371,166 L268H probably damaging Het
Cpt1a T C 19: 3,362,202 S225P probably benign Het
Dhx58 C A 11: 100,695,304 L630F probably damaging Het
Dlg2 T A 7: 91,900,773 V158E probably damaging Het
Foxd3 A G 4: 99,657,339 T239A probably benign Het
Galnt6 T C 15: 100,703,361 T346A probably damaging Het
Guca1b C G 17: 47,391,177 T185S unknown Het
H2-M5 T C 17: 36,987,679 T292A probably benign Het
Hlx T C 1: 184,727,576 H455R probably benign Het
Hydin A G 8: 110,510,867 Y1924C probably benign Het
Ighg2b C T 12: 113,306,454 V315M Het
Ildr2 A G 1: 166,307,800 K374E probably damaging Het
Jmjd1c T C 10: 67,225,842 S1144P probably benign Het
Kcnj8 T C 6: 142,566,029 D284G probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Lingo4 A G 3: 94,402,234 T160A probably benign Het
Lmod3 G T 6: 97,248,473 A129E probably benign Het
Lrrk2 T C 15: 91,726,152 C696R probably damaging Het
Mc2r A G 18: 68,407,965 F86L probably benign Het
Mfsd7a T C 5: 108,444,497 I276V probably benign Het
Mppe1 T G 18: 67,228,984 K170T probably benign Het
Mtcl1 A G 17: 66,371,330 I667T possibly damaging Het
Mtnr1a A T 8: 45,087,826 I275F probably benign Het
Myh2 A G 11: 67,197,371 I1938V probably benign Het
Npsr1 A T 9: 24,289,800 E160V probably damaging Het
Olfr156 T A 4: 43,821,086 I92F probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Ovch2 T A 7: 107,789,119 Y418F probably damaging Het
Pak7 A G 2: 136,116,559 L203S probably benign Het
Pcdh15 A T 10: 74,643,582 E508D probably benign Het
Prl7a1 T C 13: 27,642,450 M1V probably null Het
Prpsap2 G T 11: 61,756,272 N14K possibly damaging Het
Rad54b T A 4: 11,595,868 V215E probably null Het
Ryr2 G A 13: 11,792,748 T845I probably benign Het
Scgb2b3 G A 7: 31,362,014 T20I probably damaging Het
Serpina1b T C 12: 103,728,307 I393V possibly damaging Het
Slc13a5 T C 11: 72,259,064 M207V probably benign Het
Smg1 A T 7: 118,186,134 L843M unknown Het
Sp100 T C 1: 85,708,067 V531A possibly damaging Het
Srsf6 T C 2: 162,933,840 S190P unknown Het
Stil A G 4: 115,032,699 K795E possibly damaging Het
Sugp2 A G 8: 70,251,927 R705G probably benign Het
Tnfrsf11a T A 1: 105,809,374 C69S probably damaging Het
Trim30a A T 7: 104,421,449 N252K probably benign Het
Tshz1 T A 18: 84,014,607 K559* probably null Het
Ttbk1 C T 17: 46,478,938 R133H probably damaging Het
Vmn1r1 T C 1: 182,157,350 Y250C probably benign Het
Vmn2r12 A G 5: 109,086,441 L635P probably damaging Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vwa5b1 A T 4: 138,569,170 L1182* probably null Het
Washc2 A G 6: 116,248,145 D818G probably benign Het
Xylb T G 9: 119,381,545 S365A probably benign Het
Zcchc8 T C 5: 123,720,720 probably benign Het
Zdbf2 T C 1: 63,306,827 I1455T possibly damaging Het
Other mutations in Olfr788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr788 APN 10 129473211 missense probably damaging 1.00
IGL02393:Olfr788 APN 10 129473195 missense probably damaging 1.00
IGL03010:Olfr788 APN 10 129472974 missense probably damaging 1.00
IGL03325:Olfr788 APN 10 129473605 missense probably benign 0.02
R1298:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
R2215:Olfr788 UTSW 10 129473420 missense probably damaging 0.99
R5482:Olfr788 UTSW 10 129473078 missense probably benign 0.31
R5699:Olfr788 UTSW 10 129472877 missense probably damaging 1.00
R5794:Olfr788 UTSW 10 129473426 missense possibly damaging 0.95
R6436:Olfr788 UTSW 10 129472904 missense probably damaging 0.98
R6480:Olfr788 UTSW 10 129472721 missense possibly damaging 0.62
R6884:Olfr788 UTSW 10 129473154 missense probably damaging 1.00
R7989:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R8056:Olfr788 UTSW 10 129473192 missense probably benign 0.07
R8207:Olfr788 UTSW 10 129473084 missense probably benign 0.09
Z1176:Olfr788 UTSW 10 129473615 missense probably benign 0.04
Z1177:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTCATTGGAAACCTGACTATC -3'
(R):5'- AAGCACAGTAATCCTGCTGGAG -3'

Sequencing Primer
(F):5'- GAAACCTGACTATCATTGTTTTGACC -3'
(R):5'- CTGGAGCAAAAGCATAAGAGGTG -3'
Posted On2019-12-20