Incidental Mutation 'R7909:Dyrk3'
ID610324
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R7909 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131129587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 283 (V283E)
Ref Sequence ENSEMBL: ENSMUSP00000016670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably damaging
Transcript: ENSMUST00000016670
AA Change: V283E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: V283E

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189756
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,163 probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,164 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,888,177 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm11214 T C 4: 63,662,687 K75R probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 150,648,624 probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
PIT4576001:Dyrk3 UTSW 1 131130181 missense probably damaging 0.98
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R0724:Dyrk3 UTSW 1 131130140 missense probably benign 0.00
R1116:Dyrk3 UTSW 1 131129182 missense probably damaging 1.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
R7072:Dyrk3 UTSW 1 131129728 missense probably damaging 1.00
R7744:Dyrk3 UTSW 1 131129806 missense probably damaging 1.00
R7775:Dyrk3 UTSW 1 131129627 missense possibly damaging 0.84
R7961:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
R8009:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
R8298:Dyrk3 UTSW 1 131129375 missense probably damaging 1.00
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTCGATGACCTTGGTGG -3'
(R):5'- TAGCCCGGGTCTATGATCAC -3'

Sequencing Primer
(F):5'- ATGACCTTGGTGGCGCTTC -3'
(R):5'- CGGGTCTATGATCACAAACTTCGG -3'
Posted On2019-12-20