Incidental Mutation 'R0682:Ifit2'
ID61033
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission 038867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0682 (G1)
Quality Score117
Status Not validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34573612 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 184 (R184H)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect probably benign
Transcript: ENSMUST00000102826
AA Change: R184H

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: R184H

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,840 H83R probably benign Het
Abcd3 A C 3: 121,769,567 I471S possibly damaging Het
Abcg1 G A 17: 31,111,251 V509I probably benign Het
Adamts9 A T 6: 92,903,802 N497K possibly damaging Het
Agap2 A G 10: 127,083,482 S479G unknown Het
Asic2 T C 11: 80,886,680 I402V possibly damaging Het
Atp1a2 G A 1: 172,284,597 T577I probably benign Het
Atraid T A 5: 31,052,268 I92K probably damaging Het
Dpp10 C A 1: 123,905,125 A31S probably damaging Het
Erich6 A T 3: 58,636,811 F118L probably benign Het
Galnt18 T C 7: 111,520,015 Y418C probably damaging Het
Herc1 T A 9: 66,481,981 C3927S possibly damaging Het
Kif24 A T 4: 41,428,620 N113K probably benign Het
Lrp1b T A 2: 41,295,641 Y1354F probably benign Het
Muc1 T A 3: 89,231,132 I427N probably damaging Het
Muc5ac A G 7: 141,805,669 T1288A possibly damaging Het
Olfr1499 C T 19: 13,815,137 C151Y possibly damaging Het
Olfr850 C A 9: 19,477,349 M300I probably benign Het
Pex26 T A 6: 121,184,404 V47E probably damaging Het
Plekhm2 T C 4: 141,628,125 I871V probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Rnf133 A T 6: 23,649,570 I163N probably damaging Het
Rrp8 A C 7: 105,734,011 D349E probably damaging Het
Sdhd G T 9: 50,600,605 Q38K probably benign Het
Ssh1 C T 5: 113,960,657 S117N probably damaging Het
Tbc1d2b A G 9: 90,249,862 M148T probably benign Het
Tnni3k A G 3: 154,940,028 S470P probably damaging Het
Tnr C T 1: 159,852,307 Q284* probably null Het
Trim30a A C 7: 104,429,182 V229G probably damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Uck2 T C 1: 167,236,690 D90G probably damaging Het
Vmn1r229 A T 17: 20,814,688 E65V probably benign Het
Vmn2r26 A G 6: 124,061,170 E568G probably damaging Het
Whamm A G 7: 81,586,138 E363G probably damaging Het
Wrap53 A G 11: 69,562,446 S390P probably damaging Het
Wrn A G 8: 33,267,820 S814P probably benign Het
Zfp329 A G 7: 12,810,284 C438R probably damaging Het
Zkscan8 T C 13: 21,526,760 Y60C probably damaging Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTTTCCAGCCCCTACAGGATTGAG -3'
(R):5'- GCACATAGGCGTTGTTTGGCAG -3'

Sequencing Primer
(F):5'- AGGATTGAGAATCCTGCTCTTGAC -3'
(R):5'- TAAAACCTGGCTGCCCTGAG -3'
Posted On2013-07-30