Incidental Mutation 'R7909:BC028528'
ID610332
Institutional Source Beutler Lab
Gene Symbol BC028528
Ensembl Gene ENSMUSG00000038543
Gene NamecDNA sequence BC028528
SynonymsL259
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7909 (G1)
Quality Score217.468
Status Not validated
Chromosome3
Chromosomal Location95883954-95892005 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) GTGGTCACTGGTTCTGTGGTCACTGGTT to GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT at 95888163 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000090476] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm11214 T C 4: 63,662,687 K75R probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 150,648,624 probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in BC028528
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:BC028528 APN 3 95888900 missense probably damaging 1.00
R0157:BC028528 UTSW 3 95884968 critical splice donor site probably null
R0164:BC028528 UTSW 3 95887334 intron probably benign
R0306:BC028528 UTSW 3 95889820 unclassified probably benign
R1478:BC028528 UTSW 3 95891959 unclassified probably null
R4204:BC028528 UTSW 3 95889745 nonsense probably null
R4649:BC028528 UTSW 3 95888265 missense probably damaging 0.99
R5022:BC028528 UTSW 3 95888823 intron probably benign
R6541:BC028528 UTSW 3 95888218 missense probably benign 0.00
R6683:BC028528 UTSW 3 95888227 missense probably damaging 1.00
R6980:BC028528 UTSW 3 95888136 small insertion probably benign
R6980:BC028528 UTSW 3 95888139 small insertion probably benign
R6980:BC028528 UTSW 3 95888168 small insertion probably benign
R7058:BC028528 UTSW 3 95885011 missense possibly damaging 0.84
R7180:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888152 small insertion probably benign
R7308:BC028528 UTSW 3 95888169 small insertion probably benign
R7310:BC028528 UTSW 3 95888136 small insertion probably benign
R7310:BC028528 UTSW 3 95888139 small insertion probably benign
R7310:BC028528 UTSW 3 95888148 small insertion probably benign
R7310:BC028528 UTSW 3 95888173 small insertion probably benign
R7356:BC028528 UTSW 3 95888136 small insertion probably benign
R7356:BC028528 UTSW 3 95888141 small insertion probably benign
R7356:BC028528 UTSW 3 95888158 small insertion probably benign
R7356:BC028528 UTSW 3 95888165 small insertion probably benign
R7356:BC028528 UTSW 3 95888175 small insertion probably benign
R7356:BC028528 UTSW 3 95888183 small insertion probably benign
R7376:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888169 small insertion probably benign
R7490:BC028528 UTSW 3 95888136 small insertion probably benign
R7490:BC028528 UTSW 3 95888166 small insertion probably benign
R7490:BC028528 UTSW 3 95888186 small insertion probably benign
R7491:BC028528 UTSW 3 95888136 small insertion probably benign
R7491:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888136 small insertion probably benign
R7565:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888144 small insertion probably benign
R7568:BC028528 UTSW 3 95888136 small insertion probably benign
R7568:BC028528 UTSW 3 95888151 small insertion probably benign
R7568:BC028528 UTSW 3 95888172 small insertion probably benign
R7635:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888143 small insertion probably benign
R7672:BC028528 UTSW 3 95888175 small insertion probably benign
R7685:BC028528 UTSW 3 95888136 small insertion probably benign
R7685:BC028528 UTSW 3 95888153 small insertion probably benign
R7685:BC028528 UTSW 3 95888156 small insertion probably benign
R7685:BC028528 UTSW 3 95888183 nonsense probably null
R7686:BC028528 UTSW 3 95888136 small insertion probably benign
R7909:BC028528 UTSW 3 95888136 small insertion probably benign
R7909:BC028528 UTSW 3 95888164 small insertion probably benign
R7909:BC028528 UTSW 3 95888168 small insertion probably benign
R7909:BC028528 UTSW 3 95888177 small insertion probably benign
R7912:BC028528 UTSW 3 95888136 small insertion probably benign
R7912:BC028528 UTSW 3 95888138 small insertion probably benign
R7912:BC028528 UTSW 3 95888140 small insertion probably benign
R7912:BC028528 UTSW 3 95888142 small insertion probably benign
R7912:BC028528 UTSW 3 95888144 small insertion probably benign
R7912:BC028528 UTSW 3 95888154 small insertion probably benign
R7912:BC028528 UTSW 3 95888171 small insertion probably benign
R7913:BC028528 UTSW 3 95888136 small insertion probably benign
R7913:BC028528 UTSW 3 95888139 small insertion probably benign
R7913:BC028528 UTSW 3 95888142 small insertion probably benign
R7913:BC028528 UTSW 3 95888155 small insertion probably benign
R7913:BC028528 UTSW 3 95888162 small insertion probably benign
R7913:BC028528 UTSW 3 95888169 small insertion probably benign
R7913:BC028528 UTSW 3 95888182 small insertion probably benign
R7913:BC028528 UTSW 3 95888184 small insertion probably benign
R7990:BC028528 UTSW 3 95888137 small insertion probably benign
R7990:BC028528 UTSW 3 95888154 small insertion probably benign
R7990:BC028528 UTSW 3 95888161 small insertion probably benign
R7990:BC028528 UTSW 3 95888182 small insertion probably benign
R7993:BC028528 UTSW 3 95888136 small insertion probably benign
R7993:BC028528 UTSW 3 95888139 small insertion probably benign
R7993:BC028528 UTSW 3 95888166 small insertion probably benign
R7993:BC028528 UTSW 3 95888171 small insertion probably benign
R7994:BC028528 UTSW 3 95888136 small insertion probably benign
R7994:BC028528 UTSW 3 95888151 small insertion probably benign
R7994:BC028528 UTSW 3 95888175 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGTCCTCAACACAGG -3'
(R):5'- TGGAAGAAATGATAACTGTTTCCC -3'

Sequencing Primer
(F):5'- CAATTGGAGAATTGCCTCTGTCAG -3'
(R):5'- GTTTCCCAATCCTACCGAGGG -3'
Posted On2019-12-20