Incidental Mutation 'R7909:Gstm4'
ID 610337
Institutional Source Beutler Lab
Gene Symbol Gstm4
Ensembl Gene ENSMUSG00000027890
Gene Name glutathione S-transferase, mu 4
Synonyms Gstb-4, Gstb4, 1110004G14Rik
MMRRC Submission 045958-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7909 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 107947724-107952210 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107950732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 90 (T90S)
Ref Sequence ENSEMBL: ENSMUSP00000029489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029489] [ENSMUST00000106670] [ENSMUST00000178808]
AlphaFold Q8R5I6
Predicted Effect probably benign
Transcript: ENSMUST00000029489
AA Change: T90S

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029489
Gene: ENSMUSG00000027890
AA Change: T90S

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.9e-25 PFAM
Pfam:GST_N_3 13 93 1.4e-7 PFAM
Pfam:GST_C_3 42 190 7.2e-10 PFAM
Pfam:GST_C 104 192 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106670
AA Change: T56S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102281
Gene: ENSMUSG00000027890
AA Change: T56S

DomainStartEndE-ValueType
Pfam:GST_N 1 48 7e-12 PFAM
Pfam:GST_C 70 158 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178808
AA Change: T56S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136643
Gene: ENSMUSG00000027890
AA Change: T56S

DomainStartEndE-ValueType
Pfam:GST_N 1 48 7e-12 PFAM
Pfam:GST_C 70 158 1.3e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 C T 14: 54,499,087 (GRCm39) Q23* probably null Het
Acaca T A 11: 84,136,061 (GRCm39) I472N possibly damaging Het
Angptl7 T C 4: 148,580,667 (GRCm39) N320S probably benign Het
Arrdc4 C T 7: 68,394,924 (GRCm39) E112K probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,795,489 (GRCm39) probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,795,480 (GRCm39) probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,476 (GRCm39) probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,475 (GRCm39) probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Ccdc13 T A 9: 121,662,926 (GRCm39) M30L probably benign Het
Ceacam9 A G 7: 16,457,793 (GRCm39) Y102C probably damaging Het
Dennd4a G T 9: 64,780,275 (GRCm39) probably null Het
Dusp1 A T 17: 26,726,586 (GRCm39) S159T probably benign Het
Dyrk3 A T 1: 131,057,324 (GRCm39) V283E probably damaging Het
Fndc7 A T 3: 108,770,232 (GRCm39) S651T probably benign Het
Gata3os C A 2: 9,888,668 (GRCm39) P91Q unknown Het
Gcnt2 T A 13: 41,013,926 (GRCm39) H32Q probably benign Het
Gkn2 T A 6: 87,352,876 (GRCm39) H68Q possibly damaging Het
Gm11214 T C 4: 63,580,924 (GRCm39) K75R probably damaging Het
Gria4 G T 9: 4,464,450 (GRCm39) T504K probably damaging Het
Hbs1l G A 10: 21,234,303 (GRCm39) probably null Het
Hdhd5 C A 6: 120,508,152 (GRCm39) R34S probably benign Het
Ighv10-1 A T 12: 114,442,664 (GRCm39) L107* probably null Het
Ints6 A T 14: 62,996,779 (GRCm39) H70Q probably damaging Het
Iqank1 G T 15: 75,918,690 (GRCm39) R537L possibly damaging Het
Kcnc3 T A 7: 44,245,111 (GRCm39) I467N probably damaging Het
Klhl9 A T 4: 88,639,238 (GRCm39) D334E probably benign Het
Lama5 T A 2: 179,834,069 (GRCm39) N1427I possibly damaging Het
Lrch3 T A 16: 32,829,663 (GRCm39) F764L probably benign Het
Lyar T A 5: 38,382,072 (GRCm39) V18E probably damaging Het
Maea T G 5: 33,527,818 (GRCm39) F270C possibly damaging Het
Maea C T 5: 33,527,820 (GRCm39) R271* probably null Het
Mttp T A 3: 137,824,178 (GRCm39) K133* probably null Het
Nme6 T A 9: 109,671,036 (GRCm39) I92N probably damaging Het
Nqo2 T A 13: 34,156,414 (GRCm39) Y43N probably damaging Het
Nup153 C T 13: 46,847,056 (GRCm39) C791Y probably damaging Het
Ogdh A G 11: 6,263,965 (GRCm39) I134V possibly damaging Het
Or2ag19 G A 7: 106,444,199 (GRCm39) C127Y probably benign Het
Or6c207 G T 10: 129,105,136 (GRCm39) Q19K probably benign Het
Or8b12b T C 9: 37,684,033 (GRCm39) L26P probably damaging Het
Pde6b A T 5: 108,551,288 (GRCm39) M191L probably benign Het
Pira13 T C 7: 3,824,708 (GRCm39) K559R unknown Het
Plxdc1 A T 11: 97,823,130 (GRCm39) D370E probably benign Het
Pnldc1 C A 17: 13,122,098 (GRCm39) A187S probably benign Het
Psrc1 T C 3: 108,292,567 (GRCm39) V120A probably damaging Het
Rbpms A G 8: 34,354,387 (GRCm39) S53P probably damaging Het
Rtl1 G A 12: 109,556,611 (GRCm39) L1743F unknown Het
Rtl1 T A 12: 109,558,914 (GRCm39) N975I possibly damaging Het
Rtn3 A G 19: 7,433,827 (GRCm39) S722P possibly damaging Het
Safb A G 17: 56,902,665 (GRCm39) D187G unknown Het
Septin5 A G 16: 18,443,372 (GRCm39) V153A probably damaging Het
Sesn1 T C 10: 41,687,112 (GRCm39) V32A probably benign Het
Shank2 A T 7: 143,965,131 (GRCm39) H913L probably damaging Het
Slc19a1 T A 10: 76,885,374 (GRCm39) F425I probably damaging Het
Slc4a11 A G 2: 130,534,220 (GRCm39) M26T probably benign Het
Sybu G T 15: 44,536,433 (GRCm39) S631* probably null Het
Sycp1 A T 3: 102,727,942 (GRCm39) Y890* probably null Het
Tasor2 T C 13: 3,623,765 (GRCm39) I2062V possibly damaging Het
Tcaf3 A G 6: 42,568,898 (GRCm39) V583A possibly damaging Het
Tctn1 A G 5: 122,399,473 (GRCm39) V117A probably damaging Het
Tmem74 A T 15: 43,730,795 (GRCm39) S83T probably benign Het
Tmem91 T C 7: 25,369,990 (GRCm39) D94G probably damaging Het
Tnks A T 8: 35,407,858 (GRCm39) V290D probably damaging Het
Tns4 A G 11: 98,976,849 (GRCm39) L24P probably damaging Het
Tnxb A G 17: 34,911,428 (GRCm39) H1577R probably benign Het
Tpm2 A T 4: 43,515,939 (GRCm39) N279K probably benign Het
Trim34b A G 7: 103,979,731 (GRCm39) T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 149,431,620 (GRCm39) probably benign Het
Ttf1 T A 2: 28,955,471 (GRCm39) S278R probably benign Het
Utp20 A T 10: 88,611,192 (GRCm39) V1375E probably benign Het
Vmn2r52 C A 7: 9,896,877 (GRCm39) V532L probably benign Het
Vps13a G A 19: 16,697,794 (GRCm39) R774* probably null Het
Vsnl1 A T 12: 11,376,455 (GRCm39) D143E probably benign Het
Yme1l1 T A 2: 23,084,769 (GRCm39) N622K probably benign Het
Zfp106 A G 2: 120,344,700 (GRCm39) V1748A probably damaging Het
Zfp513 C T 5: 31,357,906 (GRCm39) V158M possibly damaging Het
Zfp607a A T 7: 27,578,519 (GRCm39) I530F probably damaging Het
Other mutations in Gstm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Gstm4 APN 3 107,951,263 (GRCm39) missense probably damaging 0.99
R0533:Gstm4 UTSW 3 107,950,841 (GRCm39) missense probably benign 0.02
R1799:Gstm4 UTSW 3 107,950,874 (GRCm39) missense probably damaging 1.00
R1907:Gstm4 UTSW 3 107,948,593 (GRCm39) missense probably benign 0.00
R4413:Gstm4 UTSW 3 107,950,644 (GRCm39) missense possibly damaging 0.92
R4451:Gstm4 UTSW 3 107,951,291 (GRCm39) splice site probably null
R6009:Gstm4 UTSW 3 107,950,659 (GRCm39) missense possibly damaging 0.76
R6992:Gstm4 UTSW 3 107,951,981 (GRCm39) missense possibly damaging 0.58
R7347:Gstm4 UTSW 3 107,949,689 (GRCm39) missense probably benign 0.25
R7922:Gstm4 UTSW 3 107,951,987 (GRCm39) start codon destroyed probably null 1.00
R7968:Gstm4 UTSW 3 107,951,677 (GRCm39) missense probably damaging 0.96
R8256:Gstm4 UTSW 3 107,951,667 (GRCm39) critical splice donor site probably null
R9186:Gstm4 UTSW 3 107,952,049 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- ACACATGAAACATCCTGGAGG -3'
(R):5'- GGTCACACAAGATCACGCAG -3'

Sequencing Primer
(F):5'- CACATGAAACATCCTGGAGGGTAAG -3'
(R):5'- GCAGAGCAATGCCATCCTG -3'
Posted On 2019-12-20