Incidental Mutation 'R0683:Nrp2'
ID61034
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Nameneuropilin 2
SynonymsNpn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0683 (G1)
Quality Score128
Status Not validated
Chromosome1
Chromosomal Location62703285-62818695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62744318 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 193 (T193A)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
Predicted Effect probably benign
Transcript: ENSMUST00000027112
AA Change: T193A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063594
AA Change: T193A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075144
AA Change: T193A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102822
AA Change: T193A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114155
AA Change: T193A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114157
AA Change: T193A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126344
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Exoc8 A G 8: 124,895,633 I665T probably damaging Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Gm6768 T C 12: 119,261,078 noncoding transcript Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Maml3 G A 3: 51,856,752 Q264* probably null Het
Neu1 A T 17: 34,934,325 probably null Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Serpinb13 A G 1: 106,999,021 N249S probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Zfp763 G A 17: 33,018,918 P418S probably damaging Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
Euphorbia UTSW 1 62762813 missense probably benign 0.02
Sabra UTSW 1 62783521 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1645:Nrp2 UTSW 1 62785124 missense probably damaging 0.97
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R1962:Nrp2 UTSW 1 62718931 missense probably benign 0.03
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2164:Nrp2 UTSW 1 62744355 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R2679:Nrp2 UTSW 1 62785078 missense probably benign 0.00
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7393:Nrp2 UTSW 1 62745424 missense probably damaging 0.98
R7593:Nrp2 UTSW 1 62719044 missense probably damaging 0.96
R7881:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7882:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R7948:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7958:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7959:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7960:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7961:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8009:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8012:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8014:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8015:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8068:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8069:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8070:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8071:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8206:Nrp2 UTSW 1 62747215 missense probably damaging 1.00
R8791:Nrp2 UTSW 1 62749197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAAGGATGTGTTGTTCCAAG -3'
(R):5'- GCTGGGTTGTACGTCAGAGAGATTC -3'

Sequencing Primer
(F):5'- ttctctctctccttctctccc -3'
(R):5'- gttaatcgaagtgggaagatgtg -3'
Posted On2013-07-30