Incidental Mutation 'R7909:Tcaf3'
ID 610351
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 045958-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7909 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42568898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 583 (V583A)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: V583A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: V583A

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 C T 14: 54,499,087 (GRCm39) Q23* probably null Het
Acaca T A 11: 84,136,061 (GRCm39) I472N possibly damaging Het
Angptl7 T C 4: 148,580,667 (GRCm39) N320S probably benign Het
Arrdc4 C T 7: 68,394,924 (GRCm39) E112K probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,795,489 (GRCm39) probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,795,480 (GRCm39) probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,476 (GRCm39) probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,475 (GRCm39) probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Ccdc13 T A 9: 121,662,926 (GRCm39) M30L probably benign Het
Ceacam9 A G 7: 16,457,793 (GRCm39) Y102C probably damaging Het
Dennd4a G T 9: 64,780,275 (GRCm39) probably null Het
Dusp1 A T 17: 26,726,586 (GRCm39) S159T probably benign Het
Dyrk3 A T 1: 131,057,324 (GRCm39) V283E probably damaging Het
Fndc7 A T 3: 108,770,232 (GRCm39) S651T probably benign Het
Gata3os C A 2: 9,888,668 (GRCm39) P91Q unknown Het
Gcnt2 T A 13: 41,013,926 (GRCm39) H32Q probably benign Het
Gkn2 T A 6: 87,352,876 (GRCm39) H68Q possibly damaging Het
Gm11214 T C 4: 63,580,924 (GRCm39) K75R probably damaging Het
Gria4 G T 9: 4,464,450 (GRCm39) T504K probably damaging Het
Gstm4 T A 3: 107,950,732 (GRCm39) T90S probably benign Het
Hbs1l G A 10: 21,234,303 (GRCm39) probably null Het
Hdhd5 C A 6: 120,508,152 (GRCm39) R34S probably benign Het
Ighv10-1 A T 12: 114,442,664 (GRCm39) L107* probably null Het
Ints6 A T 14: 62,996,779 (GRCm39) H70Q probably damaging Het
Iqank1 G T 15: 75,918,690 (GRCm39) R537L possibly damaging Het
Kcnc3 T A 7: 44,245,111 (GRCm39) I467N probably damaging Het
Klhl9 A T 4: 88,639,238 (GRCm39) D334E probably benign Het
Lama5 T A 2: 179,834,069 (GRCm39) N1427I possibly damaging Het
Lrch3 T A 16: 32,829,663 (GRCm39) F764L probably benign Het
Lyar T A 5: 38,382,072 (GRCm39) V18E probably damaging Het
Maea T G 5: 33,527,818 (GRCm39) F270C possibly damaging Het
Maea C T 5: 33,527,820 (GRCm39) R271* probably null Het
Mttp T A 3: 137,824,178 (GRCm39) K133* probably null Het
Nme6 T A 9: 109,671,036 (GRCm39) I92N probably damaging Het
Nqo2 T A 13: 34,156,414 (GRCm39) Y43N probably damaging Het
Nup153 C T 13: 46,847,056 (GRCm39) C791Y probably damaging Het
Ogdh A G 11: 6,263,965 (GRCm39) I134V possibly damaging Het
Or2ag19 G A 7: 106,444,199 (GRCm39) C127Y probably benign Het
Or6c207 G T 10: 129,105,136 (GRCm39) Q19K probably benign Het
Or8b12b T C 9: 37,684,033 (GRCm39) L26P probably damaging Het
Pde6b A T 5: 108,551,288 (GRCm39) M191L probably benign Het
Pira13 T C 7: 3,824,708 (GRCm39) K559R unknown Het
Plxdc1 A T 11: 97,823,130 (GRCm39) D370E probably benign Het
Pnldc1 C A 17: 13,122,098 (GRCm39) A187S probably benign Het
Psrc1 T C 3: 108,292,567 (GRCm39) V120A probably damaging Het
Rbpms A G 8: 34,354,387 (GRCm39) S53P probably damaging Het
Rtl1 G A 12: 109,556,611 (GRCm39) L1743F unknown Het
Rtl1 T A 12: 109,558,914 (GRCm39) N975I possibly damaging Het
Rtn3 A G 19: 7,433,827 (GRCm39) S722P possibly damaging Het
Safb A G 17: 56,902,665 (GRCm39) D187G unknown Het
Septin5 A G 16: 18,443,372 (GRCm39) V153A probably damaging Het
Sesn1 T C 10: 41,687,112 (GRCm39) V32A probably benign Het
Shank2 A T 7: 143,965,131 (GRCm39) H913L probably damaging Het
Slc19a1 T A 10: 76,885,374 (GRCm39) F425I probably damaging Het
Slc4a11 A G 2: 130,534,220 (GRCm39) M26T probably benign Het
Sybu G T 15: 44,536,433 (GRCm39) S631* probably null Het
Sycp1 A T 3: 102,727,942 (GRCm39) Y890* probably null Het
Tasor2 T C 13: 3,623,765 (GRCm39) I2062V possibly damaging Het
Tctn1 A G 5: 122,399,473 (GRCm39) V117A probably damaging Het
Tmem74 A T 15: 43,730,795 (GRCm39) S83T probably benign Het
Tmem91 T C 7: 25,369,990 (GRCm39) D94G probably damaging Het
Tnks A T 8: 35,407,858 (GRCm39) V290D probably damaging Het
Tns4 A G 11: 98,976,849 (GRCm39) L24P probably damaging Het
Tnxb A G 17: 34,911,428 (GRCm39) H1577R probably benign Het
Tpm2 A T 4: 43,515,939 (GRCm39) N279K probably benign Het
Trim34b A G 7: 103,979,731 (GRCm39) T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 149,431,620 (GRCm39) probably benign Het
Ttf1 T A 2: 28,955,471 (GRCm39) S278R probably benign Het
Utp20 A T 10: 88,611,192 (GRCm39) V1375E probably benign Het
Vmn2r52 C A 7: 9,896,877 (GRCm39) V532L probably benign Het
Vps13a G A 19: 16,697,794 (GRCm39) R774* probably null Het
Vsnl1 A T 12: 11,376,455 (GRCm39) D143E probably benign Het
Yme1l1 T A 2: 23,084,769 (GRCm39) N622K probably benign Het
Zfp106 A G 2: 120,344,700 (GRCm39) V1748A probably damaging Het
Zfp513 C T 5: 31,357,906 (GRCm39) V158M possibly damaging Het
Zfp607a A T 7: 27,578,519 (GRCm39) I530F probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTTTCAGACCTCCCAGAAG -3'
(R):5'- AGCCCCAAGTACTTATGAACAG -3'

Sequencing Primer
(F):5'- TTTCAGACCTCCCAGAAGAGTATTC -3'
(R):5'- ATTTGGAAACTACCTGGGATAGTG -3'
Posted On 2019-12-20