Incidental Mutation 'R0683:Serpinb13'
ID 61036
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R0683 (G1)
Quality Score 108
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106999021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 249 (N249S)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably damaging
Transcript: ENSMUST00000027564
AA Change: N249S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: N249S

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136766
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Exoc8 A G 8: 124,895,633 I665T probably damaging Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Gm6768 T C 12: 119,261,078 noncoding transcript Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Maml3 G A 3: 51,856,752 Q264* probably null Het
Neu1 A T 17: 34,934,325 probably null Het
Nrp2 A G 1: 62,744,318 T193A probably benign Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Zfp763 G A 17: 33,018,918 P418S probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAAGGCTCTTTGAACAGCTCCAC -3'
(R):5'- TTTGACAGAGATCATCCGGCAGC -3'

Sequencing Primer
(F):5'- CCAAGCTGGTGCTAATAAATACAG -3'
(R):5'- ATCATCCGGCAGCCACTTC -3'
Posted On 2013-07-30