Incidental Mutation 'R7909:Tnks'
ID 610365
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7909 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34940704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 290 (V290D)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: V290D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: V290D

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,163 probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,164 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,888,177 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm11214 T C 4: 63,662,687 K75R probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 150,648,624 probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8870:Tnks UTSW 8 34847279 critical splice donor site probably null
R8936:Tnks UTSW 8 34853347 nonsense probably null
R9049:Tnks UTSW 8 34841778 missense probably damaging 0.96
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGAGGGAGCCAATTCGAATC -3'
(R):5'- GTAGAACACTTGCTGCAGATGGG -3'

Sequencing Primer
(F):5'- GAGGGAGCCAATTCGAATCTTATTC -3'
(R):5'- CAGATGGGTGCTAATGTCCAC -3'
Posted On 2019-12-20