Incidental Mutation 'R7909:Dennd4a'
ID 610368
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 045958-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R7909 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to T at 64780275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably null
Transcript: ENSMUST00000038890
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 C T 14: 54,499,087 (GRCm39) Q23* probably null Het
Acaca T A 11: 84,136,061 (GRCm39) I472N possibly damaging Het
Angptl7 T C 4: 148,580,667 (GRCm39) N320S probably benign Het
Arrdc4 C T 7: 68,394,924 (GRCm39) E112K probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,795,489 (GRCm39) probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,795,480 (GRCm39) probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,476 (GRCm39) probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,475 (GRCm39) probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Ccdc13 T A 9: 121,662,926 (GRCm39) M30L probably benign Het
Ceacam9 A G 7: 16,457,793 (GRCm39) Y102C probably damaging Het
Dusp1 A T 17: 26,726,586 (GRCm39) S159T probably benign Het
Dyrk3 A T 1: 131,057,324 (GRCm39) V283E probably damaging Het
Fndc7 A T 3: 108,770,232 (GRCm39) S651T probably benign Het
Gata3os C A 2: 9,888,668 (GRCm39) P91Q unknown Het
Gcnt2 T A 13: 41,013,926 (GRCm39) H32Q probably benign Het
Gkn2 T A 6: 87,352,876 (GRCm39) H68Q possibly damaging Het
Gm11214 T C 4: 63,580,924 (GRCm39) K75R probably damaging Het
Gria4 G T 9: 4,464,450 (GRCm39) T504K probably damaging Het
Gstm4 T A 3: 107,950,732 (GRCm39) T90S probably benign Het
Hbs1l G A 10: 21,234,303 (GRCm39) probably null Het
Hdhd5 C A 6: 120,508,152 (GRCm39) R34S probably benign Het
Ighv10-1 A T 12: 114,442,664 (GRCm39) L107* probably null Het
Ints6 A T 14: 62,996,779 (GRCm39) H70Q probably damaging Het
Iqank1 G T 15: 75,918,690 (GRCm39) R537L possibly damaging Het
Kcnc3 T A 7: 44,245,111 (GRCm39) I467N probably damaging Het
Klhl9 A T 4: 88,639,238 (GRCm39) D334E probably benign Het
Lama5 T A 2: 179,834,069 (GRCm39) N1427I possibly damaging Het
Lrch3 T A 16: 32,829,663 (GRCm39) F764L probably benign Het
Lyar T A 5: 38,382,072 (GRCm39) V18E probably damaging Het
Maea T G 5: 33,527,818 (GRCm39) F270C possibly damaging Het
Maea C T 5: 33,527,820 (GRCm39) R271* probably null Het
Mttp T A 3: 137,824,178 (GRCm39) K133* probably null Het
Nme6 T A 9: 109,671,036 (GRCm39) I92N probably damaging Het
Nqo2 T A 13: 34,156,414 (GRCm39) Y43N probably damaging Het
Nup153 C T 13: 46,847,056 (GRCm39) C791Y probably damaging Het
Ogdh A G 11: 6,263,965 (GRCm39) I134V possibly damaging Het
Or2ag19 G A 7: 106,444,199 (GRCm39) C127Y probably benign Het
Or6c207 G T 10: 129,105,136 (GRCm39) Q19K probably benign Het
Or8b12b T C 9: 37,684,033 (GRCm39) L26P probably damaging Het
Pde6b A T 5: 108,551,288 (GRCm39) M191L probably benign Het
Pira13 T C 7: 3,824,708 (GRCm39) K559R unknown Het
Plxdc1 A T 11: 97,823,130 (GRCm39) D370E probably benign Het
Pnldc1 C A 17: 13,122,098 (GRCm39) A187S probably benign Het
Psrc1 T C 3: 108,292,567 (GRCm39) V120A probably damaging Het
Rbpms A G 8: 34,354,387 (GRCm39) S53P probably damaging Het
Rtl1 G A 12: 109,556,611 (GRCm39) L1743F unknown Het
Rtl1 T A 12: 109,558,914 (GRCm39) N975I possibly damaging Het
Rtn3 A G 19: 7,433,827 (GRCm39) S722P possibly damaging Het
Safb A G 17: 56,902,665 (GRCm39) D187G unknown Het
Septin5 A G 16: 18,443,372 (GRCm39) V153A probably damaging Het
Sesn1 T C 10: 41,687,112 (GRCm39) V32A probably benign Het
Shank2 A T 7: 143,965,131 (GRCm39) H913L probably damaging Het
Slc19a1 T A 10: 76,885,374 (GRCm39) F425I probably damaging Het
Slc4a11 A G 2: 130,534,220 (GRCm39) M26T probably benign Het
Sybu G T 15: 44,536,433 (GRCm39) S631* probably null Het
Sycp1 A T 3: 102,727,942 (GRCm39) Y890* probably null Het
Tasor2 T C 13: 3,623,765 (GRCm39) I2062V possibly damaging Het
Tcaf3 A G 6: 42,568,898 (GRCm39) V583A possibly damaging Het
Tctn1 A G 5: 122,399,473 (GRCm39) V117A probably damaging Het
Tmem74 A T 15: 43,730,795 (GRCm39) S83T probably benign Het
Tmem91 T C 7: 25,369,990 (GRCm39) D94G probably damaging Het
Tnks A T 8: 35,407,858 (GRCm39) V290D probably damaging Het
Tns4 A G 11: 98,976,849 (GRCm39) L24P probably damaging Het
Tnxb A G 17: 34,911,428 (GRCm39) H1577R probably benign Het
Tpm2 A T 4: 43,515,939 (GRCm39) N279K probably benign Het
Trim34b A G 7: 103,979,731 (GRCm39) T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 149,431,620 (GRCm39) probably benign Het
Ttf1 T A 2: 28,955,471 (GRCm39) S278R probably benign Het
Utp20 A T 10: 88,611,192 (GRCm39) V1375E probably benign Het
Vmn2r52 C A 7: 9,896,877 (GRCm39) V532L probably benign Het
Vps13a G A 19: 16,697,794 (GRCm39) R774* probably null Het
Vsnl1 A T 12: 11,376,455 (GRCm39) D143E probably benign Het
Yme1l1 T A 2: 23,084,769 (GRCm39) N622K probably benign Het
Zfp106 A G 2: 120,344,700 (GRCm39) V1748A probably damaging Het
Zfp513 C T 5: 31,357,906 (GRCm39) V158M possibly damaging Het
Zfp607a A T 7: 27,578,519 (GRCm39) I530F probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGCTCTGGGTGAAAG -3'
(R):5'- GTCACATAAAATAAGCCAGGGC -3'

Sequencing Primer
(F):5'- GAAAGTGTGCCACCATCTCTGTG -3'
(R):5'- CAGGGCTCTGCAGATTACTG -3'
Posted On 2019-12-20