Mutagenetix > Incidental Mutation

Incidental Mutation 'R0683:Rasal2'

61037

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

038868-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0683 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

156962759-157240170 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 157006779 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 111 (S111P)

Ref Sequence

ENSEMBL: ENSMUSP00000116974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543] [ENSMUST00000143358]

AlphaFold

E9PW37

Predicted Effect

probably damaging
Transcript: ENSMUST00000078308
AA Change: S239P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: S239P

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128538

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129880
AA Change: S175P

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565
AA Change: S175P

Domain	Start	End	E-Value	Type
PH	128	243	8.46e-3	SMART
Pfam:C2	252	323	1.7e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000132699
AA Change: S221P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: S221P

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134543
AA Change: S92P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565
AA Change: S92P

Domain	Start	End	E-Value	Type
PH	45	160	8.46e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143358
AA Change: S111P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116974
Gene: ENSMUSG00000070565
AA Change: S111P

Domain	Start	End	E-Value	Type
Blast:PH	1	147	2e-83	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahdc1	T	C	4: 132,792,827 (GRCm39)	F1356S	possibly damaging	Het
Atg16l2	T	C	7: 100,939,591 (GRCm39)	D533G	probably damaging	Het
Camta1	C	A	4: 151,159,597 (GRCm39)	R1614L	probably damaging	Het
Eif3i	G	T	4: 129,487,328 (GRCm39)	N162K	probably benign	Het
Exoc8	A	G	8: 125,622,372 (GRCm39)	I665T	probably damaging	Het
Ggt7	A	G	2: 155,348,428 (GRCm39)	S75P	probably benign	Het
Gjd3	A	T	11: 102,691,237 (GRCm39)	F255L	probably benign	Het
Krt1	A	G	15: 101,758,901 (GRCm39)	F88L	unknown	Het
Maml3	G	A	3: 51,764,173 (GRCm39)	Q264*	probably null	Het
Ncoa4-ps	T	C	12: 119,224,813 (GRCm39)		noncoding transcript	Het
Neu1	A	T	17: 35,153,301 (GRCm39)		probably null	Het
Nrp2	A	G	1: 62,783,477 (GRCm39)	T193A	probably benign	Het
Or4c12b	C	G	2: 89,647,522 (GRCm39)	P278R	probably damaging	Het
P4ha1	A	G	10: 59,172,969 (GRCm39)	T23A	probably benign	Het
Pgm1	A	G	4: 99,818,740 (GRCm39)	I112V	probably damaging	Het
Ptprs	A	T	17: 56,721,086 (GRCm39)	V1385D	probably damaging	Het
Serpinb13	A	G	1: 106,926,751 (GRCm39)	N249S	probably damaging	Het
Sh3pxd2a	T	C	19: 47,255,950 (GRCm39)	T923A	probably benign	Het
Speg	G	A	1: 75,405,762 (GRCm39)	A2989T	probably damaging	Het
Stard9	C	A	2: 120,504,117 (GRCm39)	S221R	probably damaging	Het
Tcp11l1	A	T	2: 104,512,237 (GRCm39)	V465E	possibly damaging	Het
Ttn	G	A	2: 76,768,653 (GRCm39)	T2973I	unknown	Het
Vav3	C	A	3: 109,559,129 (GRCm39)	Q110K	probably benign	Het
Xcr1	T	C	9: 123,684,940 (GRCm39)	D274G	probably benign	Het
Zfp763	G	A	17: 33,237,892 (GRCm39)	P418S	probably damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	156,975,387 (GRCm39)	missense	probably benign
IGL00484:Rasal2	APN	1	157,001,745 (GRCm39)	splice site	probably null
IGL00731:Rasal2	APN	1	156,985,334 (GRCm39)	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157,239,499 (GRCm39)	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	156,988,786 (GRCm39)	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	156,991,394 (GRCm39)	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157,003,502 (GRCm39)	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157,003,480 (GRCm39)	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157,003,686 (GRCm39)	missense	probably damaging	0.99
IGL01954:Rasal2	APN	1	157,005,269 (GRCm39)	missense	possibly damaging	0.83
IGL02005:Rasal2	APN	1	156,984,568 (GRCm39)	nonsense	probably null
IGL02056:Rasal2	APN	1	157,126,831 (GRCm39)	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157,126,765 (GRCm39)	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	156,977,449 (GRCm39)	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	156,984,777 (GRCm39)	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157,020,311 (GRCm39)	splice site	probably benign
R0456:Rasal2	UTSW	1	156,977,413 (GRCm39)	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	156,975,362 (GRCm39)	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	156,984,750 (GRCm39)	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157,006,779 (GRCm39)	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	156,986,266 (GRCm39)	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	156,984,891 (GRCm39)	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157,005,208 (GRCm39)	unclassified	probably benign
R1175:Rasal2	UTSW	1	156,975,218 (GRCm39)	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157,003,391 (GRCm39)	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	156,992,236 (GRCm39)	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157,057,629 (GRCm39)	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157,003,421 (GRCm39)	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	156,985,170 (GRCm39)	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157,001,730 (GRCm39)	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157,126,714 (GRCm39)	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	156,988,870 (GRCm39)	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157,071,334 (GRCm39)	intron	probably benign
R3157:Rasal2	UTSW	1	156,986,225 (GRCm39)	splice site	probably benign
R4277:Rasal2	UTSW	1	156,984,696 (GRCm39)	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157,003,402 (GRCm39)	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157,003,402 (GRCm39)	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157,003,561 (GRCm39)	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157,071,231 (GRCm39)	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157,020,374 (GRCm39)	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157,003,264 (GRCm39)	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	156,985,335 (GRCm39)	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157,126,711 (GRCm39)	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	156,985,231 (GRCm39)	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	156,984,951 (GRCm39)	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157,003,732 (GRCm39)	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	156,988,860 (GRCm39)	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157,239,432 (GRCm39)	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157,126,757 (GRCm39)	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	156,988,749 (GRCm39)	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	156,985,270 (GRCm39)	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157,020,339 (GRCm39)	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157,003,406 (GRCm39)	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157,071,218 (GRCm39)	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157,126,805 (GRCm39)	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	156,992,240 (GRCm39)	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157,071,154 (GRCm39)	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	156,984,951 (GRCm39)	missense	probably damaging	0.99
R8517:Rasal2	UTSW	1	156,973,849 (GRCm39)	critical splice acceptor site	probably null
R9021:Rasal2	UTSW	1	157,058,514 (GRCm39)	missense	unknown
RF024:Rasal2	UTSW	1	156,975,360 (GRCm39)	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157,003,243 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTCGGTCAAGAATTGCTCATGTTAT -3'
(R):5'- GGGACCTGCCAGCACACAAA -3'

Sequencing Primer
(F):5'- GCATACTAGTTGGAGAAGCTATTG -3'
(R):5'- CTGCTGTCGGGGACAGAAG -3'

Posted On

2013-07-30