Incidental Mutation 'R7909:Gcnt2'
ID610386
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7909 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40860450 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 32 (H32Q)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110191]
Predicted Effect probably benign
Transcript: ENSMUST00000110191
AA Change: H32Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: H32Q

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTGGTCACTGGTTCTGTGGTCACTGGTT GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,163 probably benign Het
BC028528 TGGTCACTGGTTCTGTGGTCACTGGTT TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,164 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCCGTGGTCACTGGTT 3: 95,888,177 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm11214 T C 4: 63,662,687 K75R probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Tro TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT X: 150,648,624 probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGACCTGGGGAAAAC -3'
(R):5'- GCCCTGAAGAGTCTCTCGAAAG -3'

Sequencing Primer
(F):5'- CGTAAGTTAAAGGAAGCTTTGCTCC -3'
(R):5'- AAGCGGGCTTCTTCTTCAGAGAG -3'
Posted On2019-12-20