Incidental Mutation 'R7910:Atrn'
ID 610416
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 045959-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7910 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130806807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 609 (H609Q)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: H609Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: H609Q

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,930,289 (GRCm39) T175S probably benign Het
Abca13 A G 11: 9,531,590 (GRCm39) I4606V probably damaging Het
Abca3 G A 17: 24,604,827 (GRCm39) V645I probably benign Het
Abi3bp A T 16: 56,498,105 (GRCm39) R980* probably null Het
Acsl6 G T 11: 54,236,797 (GRCm39) G564* probably null Het
Alppl2 T C 1: 87,015,159 (GRCm39) E430G probably benign Het
Anks1b A G 10: 90,516,654 (GRCm39) Y883C probably damaging Het
Atp11b T C 3: 35,885,652 (GRCm39) F882L possibly damaging Het
Bcl2l13 A T 6: 120,842,646 (GRCm39) K113M possibly damaging Het
Brinp2 T A 1: 158,074,450 (GRCm39) N557I probably damaging Het
C4b A G 17: 34,959,326 (GRCm39) L416P probably benign Het
Ccdc125 T A 13: 100,819,327 (GRCm39) I163K possibly damaging Het
Ccdc136 T G 6: 29,420,033 (GRCm39) D1075E probably benign Het
Cdc45 T A 16: 18,629,203 (GRCm39) Y47F probably damaging Het
Cdk10 T C 8: 123,953,105 (GRCm39) V36A probably damaging Het
Ciz1 T A 2: 32,260,139 (GRCm39) probably null Het
Clasp1 T G 1: 118,530,144 (GRCm39) L1502* probably null Het
Crtc1 G T 8: 70,840,251 (GRCm39) Q541K probably benign Het
Ddx5 G T 11: 106,675,261 (GRCm39) T358N probably damaging Het
Ehbp1l1 A T 19: 5,766,452 (GRCm39) V1297E probably benign Het
Eif2d C A 1: 131,082,950 (GRCm39) T98K probably damaging Het
Ezh2 T C 6: 47,533,077 (GRCm39) D124G probably damaging Het
Gamt T G 10: 80,094,243 (GRCm39) I223L possibly damaging Het
Gbp7 T C 3: 142,240,402 (GRCm39) V40A probably damaging Het
Gm11992 A G 11: 8,999,165 (GRCm39) E7G probably damaging Het
Gml2 A G 15: 74,692,379 (GRCm39) probably null Het
Grem2 A G 1: 174,664,813 (GRCm39) V12A probably benign Het
Gsta1 T A 9: 78,139,577 (GRCm39) I19N probably damaging Het
Gstt2 T C 10: 75,667,736 (GRCm39) I240V probably benign Het
Hectd4 T C 5: 121,392,291 (GRCm39) L185S possibly damaging Het
Hsd3b7 G A 7: 127,400,419 (GRCm39) probably null Het
Ift22 T A 5: 136,940,638 (GRCm39) M101K probably benign Het
Irs1 A G 1: 82,267,802 (GRCm39) V138A probably benign Het
Ky A G 9: 102,419,141 (GRCm39) M383V possibly damaging Het
Lama4 A G 10: 38,946,005 (GRCm39) E796G probably damaging Het
Lcp2 A G 11: 34,038,061 (GRCm39) Y426C probably damaging Het
Lig3 A G 11: 82,688,601 (GRCm39) D755G probably damaging Het
Lrrc43 T A 5: 123,630,470 (GRCm39) I111N probably damaging Het
Lrrc43 A G 5: 123,639,084 (GRCm39) D371G probably benign Het
Lrrc74b C A 16: 17,376,213 (GRCm39) G146* probably null Het
Lrrfip1 A G 1: 91,047,874 (GRCm39) K479E possibly damaging Het
Lrriq1 C A 10: 103,051,055 (GRCm39) E566* probably null Het
Mlxipl C T 5: 135,161,263 (GRCm39) A394V possibly damaging Het
Myh14 T C 7: 44,281,819 (GRCm39) Y813C probably damaging Het
Nat10 T A 2: 103,555,490 (GRCm39) E943D probably benign Het
Nectin2 T A 7: 19,466,912 (GRCm39) K226* probably null Het
Nlrc5 T G 8: 95,219,720 (GRCm39) S1103R probably benign Het
Nr4a1 T A 15: 101,169,641 (GRCm39) Y304N probably damaging Het
Ntpcr T C 8: 126,474,483 (GRCm39) V184A probably benign Het
Or1j13 T A 2: 36,369,345 (GRCm39) N266Y probably damaging Het
Or5p73 T C 7: 108,064,978 (GRCm39) V149A probably benign Het
Or5t18 A G 2: 86,637,191 (GRCm39) S51P probably benign Het
Oxr1 A C 15: 41,517,030 (GRCm39) S65R possibly damaging Het
Pcdhb19 A T 18: 37,630,720 (GRCm39) I172L probably benign Het
Pds5a A T 5: 65,795,925 (GRCm39) I655N possibly damaging Het
Pik3cg T C 12: 32,250,516 (GRCm39) Y757C probably benign Het
Plekha5 C A 6: 140,472,184 (GRCm39) T37N possibly damaging Het
Ppp4r1 T A 17: 66,118,298 (GRCm39) F167I probably benign Het
Ppp4r1 C T 17: 66,136,394 (GRCm39) A534V probably damaging Het
Ppt2 T A 17: 34,846,300 (GRCm39) probably null Het
Prrt2 A T 7: 126,619,219 (GRCm39) V82D possibly damaging Het
Rassf5 T A 1: 131,108,366 (GRCm39) Y338F probably benign Het
Rbbp6 G A 7: 122,596,251 (GRCm39) V560I possibly damaging Het
Rcbtb1 T C 14: 59,474,127 (GRCm39) M90T unknown Het
Rif1 T A 2: 51,968,399 (GRCm39) L194* probably null Het
Rybp A T 6: 100,209,879 (GRCm39) I128K possibly damaging Het
Samm50 T G 15: 84,098,346 (GRCm39) F462V possibly damaging Het
Slain1 T C 14: 103,923,200 (GRCm39) Y264H probably damaging Het
Slc29a4 C T 5: 142,691,156 (GRCm39) P12L probably benign Het
Slc6a2 T C 8: 93,720,766 (GRCm39) I461T possibly damaging Het
Soat2 A G 15: 102,069,106 (GRCm39) D377G probably damaging Het
Spocd1 A G 4: 129,823,893 (GRCm39) E230G Het
Tbc1d30 T A 10: 121,183,061 (GRCm39) K126* probably null Het
Tgfbi T A 13: 56,779,997 (GRCm39) F515L probably damaging Het
Utf1 A G 7: 139,524,704 (GRCm39) probably benign Het
Vmn1r206 G T 13: 22,804,471 (GRCm39) Y245* probably null Het
Vmn1r87 T A 7: 12,865,832 (GRCm39) S152C probably damaging Het
Zfc3h1 C A 10: 115,256,588 (GRCm39) Y1519* probably null Het
Zfp248 A T 6: 118,407,103 (GRCm39) L162H possibly damaging Het
Zfp804a T A 2: 82,086,917 (GRCm39) F249I probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTGTGGATGAGGCATTC -3'
(R):5'- TCGTGCACTTAGAACTGCCTTC -3'

Sequencing Primer
(F):5'- ACCTGGCTGTCTGAAACTCAGTAG -3'
(R):5'- GCACTTAGAACTGCCTTCTCTCC -3'
Posted On 2019-12-20