Incidental Mutation 'R7910:Atp11b'
ID610417
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R7910 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35831503 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 882 (F882L)
Ref Sequence ENSEMBL: ENSMUSP00000029257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029257
AA Change: F882L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: F882L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198599
AA Change: F682L

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: F682L

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abca3 G A 17: 24,385,853 V645I probably benign Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
C4b A G 17: 34,740,352 L416P probably benign Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Ppt2 T A 17: 34,627,326 probably null Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp248 A T 6: 118,430,142 L162H possibly damaging Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7614:Atp11b UTSW 3 35810110 splice site probably null
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7991:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTAAGTGCAGCTATAGCAAC -3'
(R):5'- CTATCACGTTGTGTCCAGTGG -3'

Sequencing Primer
(F):5'- TTGCAGGAATCATGGGT -3'
(R):5'- TTGTGTCCAGTGGCAACC -3'
Posted On2019-12-20