Incidental Mutation 'R0683:Maml3'
ID61043
Institutional Source Beutler Lab
Gene Symbol Maml3
Ensembl Gene ENSMUSG00000061143
Gene Namemastermind like transcriptional coactivator 3
Synonyms
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0683 (G1)
Quality Score96
Status Not validated
Chromosome3
Chromosomal Location51685907-52105076 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 51856752 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 264 (Q264*)
Ref Sequence ENSEMBL: ENSMUSP00000112637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121440]
Predicted Effect probably null
Transcript: ENSMUST00000121440
AA Change: Q264*
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143
AA Change: Q264*

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Exoc8 A G 8: 124,895,633 I665T probably damaging Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Gm6768 T C 12: 119,261,078 noncoding transcript Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Neu1 A T 17: 34,934,325 probably null Het
Nrp2 A G 1: 62,744,318 T193A probably benign Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Serpinb13 A G 1: 106,999,021 N249S probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Zfp763 G A 17: 33,018,918 P418S probably damaging Het
Other mutations in Maml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Maml3 APN 3 51690704 missense probably benign 0.13
IGL01138:Maml3 APN 3 51690558 missense possibly damaging 0.87
IGL02173:Maml3 APN 3 51690787 missense probably damaging 0.96
IGL02220:Maml3 APN 3 51690218 missense possibly damaging 0.94
IGL02725:Maml3 APN 3 52103774 missense probably damaging 0.97
IGL02838:Maml3 APN 3 51690090 missense probably damaging 1.00
R1966:Maml3 UTSW 3 52104139 missense unknown
R1980:Maml3 UTSW 3 52104052 missense unknown
R1989:Maml3 UTSW 3 51697758 missense probably damaging 0.98
R1992:Maml3 UTSW 3 51690757 missense probably benign 0.01
R2047:Maml3 UTSW 3 51690445 missense probably damaging 1.00
R2113:Maml3 UTSW 3 51690656 missense probably damaging 1.00
R2876:Maml3 UTSW 3 51690059 missense possibly damaging 0.86
R3176:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R3276:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R4191:Maml3 UTSW 3 51689969 missense probably benign
R4576:Maml3 UTSW 3 51856506 nonsense probably null
R4609:Maml3 UTSW 3 51855592 missense probably damaging 1.00
R4628:Maml3 UTSW 3 51796470 intron probably benign
R4734:Maml3 UTSW 3 51689875 missense probably damaging 1.00
R4776:Maml3 UTSW 3 51856532 missense probably benign 0.28
R4868:Maml3 UTSW 3 52103924 nonsense probably null
R4889:Maml3 UTSW 3 51694510 intron probably benign
R4891:Maml3 UTSW 3 51694510 intron probably benign
R4947:Maml3 UTSW 3 51856539 missense probably benign 0.01
R5011:Maml3 UTSW 3 51690775 missense possibly damaging 0.87
R5047:Maml3 UTSW 3 51690841 missense possibly damaging 0.88
R5344:Maml3 UTSW 3 52103725 missense probably damaging 0.99
R5743:Maml3 UTSW 3 52104132 missense unknown
R6724:Maml3 UTSW 3 51855875 missense probably damaging 1.00
R6885:Maml3 UTSW 3 51697579
R6938:Maml3 UTSW 3 52103738 missense probably damaging 0.98
R7581:Maml3 UTSW 3 51856768 missense probably benign 0.06
R7895:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R7978:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R8059:Maml3 UTSW 3 51856689 missense probably damaging 1.00
RF022:Maml3 UTSW 3 51856662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCTGTGAGAACTCCTGCTCC -3'
(R):5'- TTTGCCCAACAACATGCCCCTG -3'

Sequencing Primer
(F):5'- AAGTCTTCATTGAACAGGTCCTGG -3'
(R):5'- TGGGCTTCTGGAAGATCTGA -3'
Posted On2013-07-30