Incidental Mutation 'R7910:Zfp248'
ID610431
Institutional Source Beutler Lab
Gene Symbol Zfp248
Ensembl Gene ENSMUSG00000030145
Gene Namezinc finger protein 248
SynonymsE130106N01Rik, 2810037F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7910 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location118427319-118455528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118430142 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 162 (L162H)
Ref Sequence ENSEMBL: ENSMUSP00000068807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069292] [ENSMUST00000159403] [ENSMUST00000161519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069292
AA Change: L162H

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068807
Gene: ENSMUSG00000030145
AA Change: L162H

DomainStartEndE-ValueType
KRAB 8 68 2.4e-35 SMART
internal_repeat_1 209 375 2.52e-18 PROSPERO
ZnF_C2H2 377 399 3.89e-3 SMART
ZnF_C2H2 405 427 3.95e-4 SMART
ZnF_C2H2 433 455 4.24e-4 SMART
ZnF_C2H2 461 483 8.94e-3 SMART
ZnF_C2H2 489 511 8.47e-4 SMART
ZnF_C2H2 517 539 8.02e-5 SMART
ZnF_C2H2 545 567 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159403
Predicted Effect possibly damaging
Transcript: ENSMUST00000161519
AA Change: L61H

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124539
Gene: ENSMUSG00000030145
AA Change: L61H

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 165 188 3.3e-2 PFAM
ZnF_C2H2 276 298 3.89e-3 SMART
ZnF_C2H2 304 326 3.95e-4 SMART
ZnF_C2H2 332 354 4.24e-4 SMART
ZnF_C2H2 360 382 8.94e-3 SMART
ZnF_C2H2 388 410 8.47e-4 SMART
ZnF_C2H2 416 438 8.02e-5 SMART
ZnF_C2H2 444 466 6.52e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abca3 G A 17: 24,385,853 V645I probably benign Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atp11b T C 3: 35,831,503 F882L possibly damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
C4b A G 17: 34,740,352 L416P probably benign Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Ppt2 T A 17: 34,627,326 probably null Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in Zfp248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Zfp248 APN 6 118429732 missense probably damaging 1.00
IGL02268:Zfp248 APN 6 118453840 intron probably benign
R1374:Zfp248 UTSW 6 118433373 missense probably damaging 1.00
R1678:Zfp248 UTSW 6 118429804 missense probably benign 0.02
R1794:Zfp248 UTSW 6 118429303 missense probably damaging 1.00
R1834:Zfp248 UTSW 6 118428970 missense probably damaging 0.98
R3900:Zfp248 UTSW 6 118429566 missense probably damaging 1.00
R3948:Zfp248 UTSW 6 118430194 frame shift probably null
R4661:Zfp248 UTSW 6 118433307 missense possibly damaging 0.84
R4810:Zfp248 UTSW 6 118429846 missense possibly damaging 0.68
R4924:Zfp248 UTSW 6 118429072 missense probably damaging 1.00
R4926:Zfp248 UTSW 6 118429826 missense possibly damaging 0.74
R7326:Zfp248 UTSW 6 118430209 missense probably damaging 1.00
R7357:Zfp248 UTSW 6 118429657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTCTGACTTGTACAAAGGGC -3'
(R):5'- TGGCCACTCATGTTCACCAAC -3'

Sequencing Primer
(F):5'- TGACTTGTACAAAGGGCCACTTC -3'
(R):5'- GCCACTCATGTTCACCAACAAGATC -3'
Posted On2019-12-20