Incidental Mutation 'R7910:Utf1'
ID610441
Institutional Source Beutler Lab
Gene Symbol Utf1
Ensembl Gene ENSMUSG00000047751
Gene Nameundifferentiated embryonic cell transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R7910 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139943789-139945112 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 139944791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000168457]
Predicted Effect probably benign
Transcript: ENSMUST00000053445
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Predicted Effect unknown
Transcript: ENSMUST00000168457
AA Change: N274S
SMART Domains Protein: ENSMUSP00000128848
Gene: ENSMUSG00000047751
AA Change: N274S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Myb_DNA-bind_4 60 139 1e-9 PFAM
low complexity region 156 194 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
SCOP:d1e7la2 246 314 1e-2 SMART
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine zipper-containing transcriptional coactivator that may link the upstream activator ATF2 with the basal transcription complex. The encoded protein is closely associated with chromatin and is required for the proper differentiation of embryonic carcinoma and embryonic stem cells. Found nearly exclusively in pluripotent cells, this protein can also serve as a transcriptional repressor. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation and background sensitive neo- and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abca3 G A 17: 24,385,853 V645I probably benign Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atp11b T C 3: 35,831,503 F882L possibly damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
C4b A G 17: 34,740,352 L416P probably benign Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Ppt2 T A 17: 34,627,326 probably null Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp248 A T 6: 118,430,142 L162H possibly damaging Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in Utf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Utf1 APN 7 139944016 nonsense probably null
IGL02988:Utf1 UTSW 7 139943962 missense possibly damaging 0.92
R1813:Utf1 UTSW 7 139944300 missense probably damaging 0.96
R1896:Utf1 UTSW 7 139944300 missense probably damaging 0.96
R2079:Utf1 UTSW 7 139944895 nonsense probably null
R2176:Utf1 UTSW 7 139944007 missense possibly damaging 0.92
R5052:Utf1 UTSW 7 139944901 unclassified probably benign
R5554:Utf1 UTSW 7 139943946 missense probably benign
R5754:Utf1 UTSW 7 139944791 unclassified probably benign
R7503:Utf1 UTSW 7 139944133 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCAGTTCTTCCACGACGAAG -3'
(R):5'- TTATTGGCGCAAGTCCCCAAG -3'

Sequencing Primer
(F):5'- ACGAAGTCTGCAGGTGC -3'
(R):5'- GCAAGTCCCCAAGGATGC -3'
Posted On2019-12-20