Incidental Mutation 'R7910:Lrriq1'
ID 610453
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 045959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7910 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 103051055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 566 (E566*)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably null
Transcript: ENSMUST00000020043
AA Change: E566*
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: E566*

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166240
AA Change: E566*
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: E566*

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,930,289 (GRCm39) T175S probably benign Het
Abca13 A G 11: 9,531,590 (GRCm39) I4606V probably damaging Het
Abca3 G A 17: 24,604,827 (GRCm39) V645I probably benign Het
Abi3bp A T 16: 56,498,105 (GRCm39) R980* probably null Het
Acsl6 G T 11: 54,236,797 (GRCm39) G564* probably null Het
Alppl2 T C 1: 87,015,159 (GRCm39) E430G probably benign Het
Anks1b A G 10: 90,516,654 (GRCm39) Y883C probably damaging Het
Atp11b T C 3: 35,885,652 (GRCm39) F882L possibly damaging Het
Atrn T A 2: 130,806,807 (GRCm39) H609Q probably benign Het
Bcl2l13 A T 6: 120,842,646 (GRCm39) K113M possibly damaging Het
Brinp2 T A 1: 158,074,450 (GRCm39) N557I probably damaging Het
C4b A G 17: 34,959,326 (GRCm39) L416P probably benign Het
Ccdc125 T A 13: 100,819,327 (GRCm39) I163K possibly damaging Het
Ccdc136 T G 6: 29,420,033 (GRCm39) D1075E probably benign Het
Cdc45 T A 16: 18,629,203 (GRCm39) Y47F probably damaging Het
Cdk10 T C 8: 123,953,105 (GRCm39) V36A probably damaging Het
Ciz1 T A 2: 32,260,139 (GRCm39) probably null Het
Clasp1 T G 1: 118,530,144 (GRCm39) L1502* probably null Het
Crtc1 G T 8: 70,840,251 (GRCm39) Q541K probably benign Het
Ddx5 G T 11: 106,675,261 (GRCm39) T358N probably damaging Het
Ehbp1l1 A T 19: 5,766,452 (GRCm39) V1297E probably benign Het
Eif2d C A 1: 131,082,950 (GRCm39) T98K probably damaging Het
Ezh2 T C 6: 47,533,077 (GRCm39) D124G probably damaging Het
Gamt T G 10: 80,094,243 (GRCm39) I223L possibly damaging Het
Gbp7 T C 3: 142,240,402 (GRCm39) V40A probably damaging Het
Gm11992 A G 11: 8,999,165 (GRCm39) E7G probably damaging Het
Gml2 A G 15: 74,692,379 (GRCm39) probably null Het
Grem2 A G 1: 174,664,813 (GRCm39) V12A probably benign Het
Gsta1 T A 9: 78,139,577 (GRCm39) I19N probably damaging Het
Gstt2 T C 10: 75,667,736 (GRCm39) I240V probably benign Het
Hectd4 T C 5: 121,392,291 (GRCm39) L185S possibly damaging Het
Hsd3b7 G A 7: 127,400,419 (GRCm39) probably null Het
Ift22 T A 5: 136,940,638 (GRCm39) M101K probably benign Het
Irs1 A G 1: 82,267,802 (GRCm39) V138A probably benign Het
Ky A G 9: 102,419,141 (GRCm39) M383V possibly damaging Het
Lama4 A G 10: 38,946,005 (GRCm39) E796G probably damaging Het
Lcp2 A G 11: 34,038,061 (GRCm39) Y426C probably damaging Het
Lig3 A G 11: 82,688,601 (GRCm39) D755G probably damaging Het
Lrrc43 A G 5: 123,639,084 (GRCm39) D371G probably benign Het
Lrrc43 T A 5: 123,630,470 (GRCm39) I111N probably damaging Het
Lrrc74b C A 16: 17,376,213 (GRCm39) G146* probably null Het
Lrrfip1 A G 1: 91,047,874 (GRCm39) K479E possibly damaging Het
Mlxipl C T 5: 135,161,263 (GRCm39) A394V possibly damaging Het
Myh14 T C 7: 44,281,819 (GRCm39) Y813C probably damaging Het
Nat10 T A 2: 103,555,490 (GRCm39) E943D probably benign Het
Nectin2 T A 7: 19,466,912 (GRCm39) K226* probably null Het
Nlrc5 T G 8: 95,219,720 (GRCm39) S1103R probably benign Het
Nr4a1 T A 15: 101,169,641 (GRCm39) Y304N probably damaging Het
Ntpcr T C 8: 126,474,483 (GRCm39) V184A probably benign Het
Or1j13 T A 2: 36,369,345 (GRCm39) N266Y probably damaging Het
Or5p73 T C 7: 108,064,978 (GRCm39) V149A probably benign Het
Or5t18 A G 2: 86,637,191 (GRCm39) S51P probably benign Het
Oxr1 A C 15: 41,517,030 (GRCm39) S65R possibly damaging Het
Pcdhb19 A T 18: 37,630,720 (GRCm39) I172L probably benign Het
Pds5a A T 5: 65,795,925 (GRCm39) I655N possibly damaging Het
Pik3cg T C 12: 32,250,516 (GRCm39) Y757C probably benign Het
Plekha5 C A 6: 140,472,184 (GRCm39) T37N possibly damaging Het
Ppp4r1 T A 17: 66,118,298 (GRCm39) F167I probably benign Het
Ppp4r1 C T 17: 66,136,394 (GRCm39) A534V probably damaging Het
Ppt2 T A 17: 34,846,300 (GRCm39) probably null Het
Prrt2 A T 7: 126,619,219 (GRCm39) V82D possibly damaging Het
Rassf5 T A 1: 131,108,366 (GRCm39) Y338F probably benign Het
Rbbp6 G A 7: 122,596,251 (GRCm39) V560I possibly damaging Het
Rcbtb1 T C 14: 59,474,127 (GRCm39) M90T unknown Het
Rif1 T A 2: 51,968,399 (GRCm39) L194* probably null Het
Rybp A T 6: 100,209,879 (GRCm39) I128K possibly damaging Het
Samm50 T G 15: 84,098,346 (GRCm39) F462V possibly damaging Het
Slain1 T C 14: 103,923,200 (GRCm39) Y264H probably damaging Het
Slc29a4 C T 5: 142,691,156 (GRCm39) P12L probably benign Het
Slc6a2 T C 8: 93,720,766 (GRCm39) I461T possibly damaging Het
Soat2 A G 15: 102,069,106 (GRCm39) D377G probably damaging Het
Spocd1 A G 4: 129,823,893 (GRCm39) E230G Het
Tbc1d30 T A 10: 121,183,061 (GRCm39) K126* probably null Het
Tgfbi T A 13: 56,779,997 (GRCm39) F515L probably damaging Het
Utf1 A G 7: 139,524,704 (GRCm39) probably benign Het
Vmn1r206 G T 13: 22,804,471 (GRCm39) Y245* probably null Het
Vmn1r87 T A 7: 12,865,832 (GRCm39) S152C probably damaging Het
Zfc3h1 C A 10: 115,256,588 (GRCm39) Y1519* probably null Het
Zfp248 A T 6: 118,407,103 (GRCm39) L162H possibly damaging Het
Zfp804a T A 2: 82,086,917 (GRCm39) F249I probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTTTCTGCATGGAAATAG -3'
(R):5'- CCAAACCAGGCAATTTTGGTAG -3'

Sequencing Primer
(F):5'- TTCTGCATGGAAATAGGTGAGC -3'
(R):5'- ACCAATGTTCAGAACAACCTTC -3'
Posted On 2019-12-20