Mutagenetix > Incidental Mutation

Incidental Mutation 'R7910:Lrriq1'

610453

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R7910 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 103215194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 566 (E566*)

Ref Sequence

ENSEMBL: ENSMUSP00000020043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably null
Transcript: ENSMUST00000020043
AA Change: E566*

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: E566*

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166240
AA Change: E566*

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: E566*

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	A	T	6: 65,953,305	T175S	probably benign	Het
Abca13	A	G	11: 9,581,590	I4606V	probably damaging	Het
Abca3	G	A	17: 24,385,853	V645I	probably benign	Het
Abi3bp	A	T	16: 56,677,742	R980*	probably null	Het
Acsl6	G	T	11: 54,345,971	G564*	probably null	Het
Alppl2	T	C	1: 87,087,437	E430G	probably benign	Het
Anks1b	A	G	10: 90,680,792	Y883C	probably damaging	Het
Atp11b	T	C	3: 35,831,503	F882L	possibly damaging	Het
Atrn	T	A	2: 130,964,887	H609Q	probably benign	Het
Bcl2l13	A	T	6: 120,865,685	K113M	possibly damaging	Het
Brinp2	T	A	1: 158,246,880	N557I	probably damaging	Het
C4b	A	G	17: 34,740,352	L416P	probably benign	Het
Ccdc125	T	A	13: 100,682,819	I163K	possibly damaging	Het
Ccdc136	T	G	6: 29,420,034	D1075E	probably benign	Het
Cdc45	T	A	16: 18,810,453	Y47F	probably damaging	Het
Cdk10	T	C	8: 123,226,366	V36A	probably damaging	Het
Ciz1	T	A	2: 32,370,127		probably null	Het
Clasp1	T	G	1: 118,602,414	L1502*	probably null	Het
Crtc1	G	T	8: 70,387,601	Q541K	probably benign	Het
Ddx5	G	T	11: 106,784,435	T358N	probably damaging	Het
Ehbp1l1	A	T	19: 5,716,424	V1297E	probably benign	Het
Eif2d	C	A	1: 131,155,213	T98K	probably damaging	Het
Ezh2	T	C	6: 47,556,143	D124G	probably damaging	Het
Gamt	T	G	10: 80,258,409	I223L	possibly damaging	Het
Gbp7	T	C	3: 142,534,641	V40A	probably damaging	Het
Gm11992	A	G	11: 9,049,165	E7G	probably damaging	Het
Gml2	A	G	15: 74,820,530		probably null	Het
Grem2	A	G	1: 174,837,247	V12A	probably benign	Het
Gsta1	T	A	9: 78,232,295	I19N	probably damaging	Het
Gstt2	T	C	10: 75,831,902	I240V	probably benign	Het
Hectd4	T	C	5: 121,254,228	L185S	possibly damaging	Het
Hsd3b7	G	A	7: 127,801,247		probably null	Het
Ift22	T	A	5: 136,911,784	M101K	probably benign	Het
Irs1	A	G	1: 82,290,081	V138A	probably benign	Het
Ky	A	G	9: 102,541,942	M383V	possibly damaging	Het
Lama4	A	G	10: 39,070,009	E796G	probably damaging	Het
Lcp2	A	G	11: 34,088,061	Y426C	probably damaging	Het
Lig3	A	G	11: 82,797,775	D755G	probably damaging	Het
Lrrc43	T	A	5: 123,492,407	I111N	probably damaging	Het
Lrrc43	A	G	5: 123,501,021	D371G	probably benign	Het
Lrrc74b	C	A	16: 17,558,349	G146*	probably null	Het
Lrrfip1	A	G	1: 91,120,152	K479E	possibly damaging	Het
Mlxipl	C	T	5: 135,132,409	A394V	possibly damaging	Het
Myh14	T	C	7: 44,632,395	Y813C	probably damaging	Het
Nat10	T	A	2: 103,725,145	E943D	probably benign	Het
Nectin2	T	A	7: 19,732,987	K226*	probably null	Het
Nlrc5	T	G	8: 94,493,092	S1103R	probably benign	Het
Nr4a1	T	A	15: 101,271,760	Y304N	probably damaging	Het
Ntpcr	T	C	8: 125,747,744	V184A	probably benign	Het
Olfr141	A	G	2: 86,806,847	S51P	probably benign	Het
Olfr341	T	A	2: 36,479,333	N266Y	probably damaging	Het
Olfr498	T	C	7: 108,465,771	V149A	probably benign	Het
Oxr1	A	C	15: 41,653,634	S65R	possibly damaging	Het
Pcdhb19	A	T	18: 37,497,667	I172L	probably benign	Het
Pds5a	A	T	5: 65,638,582	I655N	possibly damaging	Het
Pik3cg	T	C	12: 32,200,517	Y757C	probably benign	Het
Plekha5	C	A	6: 140,526,458	T37N	possibly damaging	Het
Ppp4r1	T	A	17: 65,811,303	F167I	probably benign	Het
Ppp4r1	C	T	17: 65,829,399	A534V	probably damaging	Het
Ppt2	T	A	17: 34,627,326		probably null	Het
Prrt2	A	T	7: 127,020,047	V82D	possibly damaging	Het
Rassf5	T	A	1: 131,180,629	Y338F	probably benign	Het
Rbbp6	G	A	7: 122,997,028	V560I	possibly damaging	Het
Rcbtb1	T	C	14: 59,236,678	M90T	unknown	Het
Rif1	T	A	2: 52,078,387	L194*	probably null	Het
Rybp	A	T	6: 100,232,918	I128K	possibly damaging	Het
Samm50	T	G	15: 84,214,145	F462V	possibly damaging	Het
Slain1	T	C	14: 103,685,764	Y264H	probably damaging	Het
Slc29a4	C	T	5: 142,705,401	P12L	probably benign	Het
Slc6a2	T	C	8: 92,994,138	I461T	possibly damaging	Het
Soat2	A	G	15: 102,160,671	D377G	probably damaging	Het
Spocd1	A	G	4: 129,930,100	E230G		Het
Tbc1d30	T	A	10: 121,347,156	K126*	probably null	Het
Tgfbi	T	A	13: 56,632,184	F515L	probably damaging	Het
Utf1	A	G	7: 139,944,791		probably benign	Het
Vmn1r206	G	T	13: 22,620,301	Y245*	probably null	Het
Vmn1r87	T	A	7: 13,131,905	S152C	probably damaging	Het
Zfc3h1	C	A	10: 115,420,683	Y1519*	probably null	Het
Zfp248	A	T	6: 118,430,142	L162H	possibly damaging	Het
Zfp804a	T	A	2: 82,256,573	F249I	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGCTTTTCTGCATGGAAATAG -3'
(R):5'- CCAAACCAGGCAATTTTGGTAG -3'

Sequencing Primer
(F):5'- TTCTGCATGGAAATAGGTGAGC -3'
(R):5'- ACCAATGTTCAGAACAACCTTC -3'

Posted On

2019-12-20