Incidental Mutation 'R7910:Abca3'
ID610476
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7910 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24385853 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 645 (V645I)
Ref Sequence ENSEMBL: ENSMUSP00000045285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably benign
Transcript: ENSMUST00000039013
AA Change: V645I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: V645I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079594
AA Change: V645I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: V645I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: V645I
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: V645I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atp11b T C 3: 35,831,503 F882L possibly damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
C4b A G 17: 34,740,352 L416P probably benign Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Ppt2 T A 17: 34,627,326 probably null Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp248 A T 6: 118,430,142 L162H possibly damaging Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7848:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7931:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7942:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7960:Abca3 UTSW 17 24384023 nonsense probably null
R7976:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7991:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7992:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATGCCATTAGCCTCACATCGG -3'
(R):5'- ACCCAGGGTTTGTCCTTGTG -3'

Sequencing Primer
(F):5'- TAGCCTCACATCGGTCTGTTTTGAG -3'
(R):5'- CCTTGTGTGGGAGCCTGC -3'
Posted On2019-12-20