Incidental Mutation 'R7910:Ppt2'
ID610477
Institutional Source Beutler Lab
Gene Symbol Ppt2
Ensembl Gene ENSMUSG00000015474
Gene Namepalmitoyl-protein thioesterase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7910 (G1)
Quality Score160.009
Status Not validated
Chromosome17
Chromosomal Location34616662-34628510 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34627326 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015620] [ENSMUST00000064953] [ENSMUST00000166040] [ENSMUST00000167097] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000169287] [ENSMUST00000170345] [ENSMUST00000171121] [ENSMUST00000171376]
Predicted Effect probably benign
Transcript: ENSMUST00000015620
SMART Domains Protein: ENSMUSP00000015620
Gene: ENSMUSG00000015476

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
low complexity region 57 79 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
Pfam:CD225 214 286 3.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064953
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166040
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167097
SMART Domains Protein: ENSMUSP00000125937
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 236 7.7e-12 PFAM
Pfam:Abhydrolase_6 39 236 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168391
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169067
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169287
SMART Domains Protein: ENSMUSP00000129421
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
PDB:1PJA|A 1 102 2e-42 PDB
SCOP:d1fj2a_ 29 91 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169969
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170345
SMART Domains Protein: ENSMUSP00000127707
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 33 203 1.6e-9 PFAM
Pfam:Abhydrolase_6 39 201 2.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171121
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171376
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants show autofluorescent storage material in brain, abnormal clasping behavior, spasticity, ataxia and increased adult mortality. In addition, lipofuscin pigments in pancreas, bone marrow histiocytosis and splenomegaly are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abca3 G A 17: 24,385,853 V645I probably benign Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atp11b T C 3: 35,831,503 F882L possibly damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
C4b A G 17: 34,740,352 L416P probably benign Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp248 A T 6: 118,430,142 L162H possibly damaging Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in Ppt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Ppt2 APN 17 34625754 splice site probably benign
R0180:Ppt2 UTSW 17 34626503 missense probably damaging 1.00
R0685:Ppt2 UTSW 17 34626572 missense probably damaging 0.98
R1498:Ppt2 UTSW 17 34623101 missense probably benign 0.00
R2058:Ppt2 UTSW 17 34622844 splice site probably benign
R2059:Ppt2 UTSW 17 34622844 splice site probably benign
R3919:Ppt2 UTSW 17 34622923 missense probably damaging 1.00
R4622:Ppt2 UTSW 17 34625901 missense probably benign 0.16
R5582:Ppt2 UTSW 17 34617399 missense probably damaging 0.99
R5638:Ppt2 UTSW 17 34625849 missense probably benign 0.37
R6502:Ppt2 UTSW 17 34625920 missense probably damaging 1.00
R7065:Ppt2 UTSW 17 34622855 missense probably damaging 1.00
R7523:Ppt2 UTSW 17 34626803 critical splice donor site probably null
R7587:Ppt2 UTSW 17 34626803 critical splice donor site probably null
R7782:Ppt2 UTSW 17 34625712 missense probably benign 0.05
R8708:Ppt2 UTSW 17 34625639 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGATGGCTCGGCACAAACAC -3'
(R):5'- CCAGTTCTTTGGGTGCAATG -3'

Sequencing Primer
(F):5'- GCTCGGCACAAACACCTACC -3'
(R):5'- TGTTGCCAGGGAAAGTCC -3'
Posted On2019-12-20