Incidental Mutation 'R7910:C4b'
ID 610478
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 045959-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7910 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34959326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 416 (L416P)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: L416P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: L416P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,930,289 (GRCm39) T175S probably benign Het
Abca13 A G 11: 9,531,590 (GRCm39) I4606V probably damaging Het
Abca3 G A 17: 24,604,827 (GRCm39) V645I probably benign Het
Abi3bp A T 16: 56,498,105 (GRCm39) R980* probably null Het
Acsl6 G T 11: 54,236,797 (GRCm39) G564* probably null Het
Alppl2 T C 1: 87,015,159 (GRCm39) E430G probably benign Het
Anks1b A G 10: 90,516,654 (GRCm39) Y883C probably damaging Het
Atp11b T C 3: 35,885,652 (GRCm39) F882L possibly damaging Het
Atrn T A 2: 130,806,807 (GRCm39) H609Q probably benign Het
Bcl2l13 A T 6: 120,842,646 (GRCm39) K113M possibly damaging Het
Brinp2 T A 1: 158,074,450 (GRCm39) N557I probably damaging Het
Ccdc125 T A 13: 100,819,327 (GRCm39) I163K possibly damaging Het
Ccdc136 T G 6: 29,420,033 (GRCm39) D1075E probably benign Het
Cdc45 T A 16: 18,629,203 (GRCm39) Y47F probably damaging Het
Cdk10 T C 8: 123,953,105 (GRCm39) V36A probably damaging Het
Ciz1 T A 2: 32,260,139 (GRCm39) probably null Het
Clasp1 T G 1: 118,530,144 (GRCm39) L1502* probably null Het
Crtc1 G T 8: 70,840,251 (GRCm39) Q541K probably benign Het
Ddx5 G T 11: 106,675,261 (GRCm39) T358N probably damaging Het
Ehbp1l1 A T 19: 5,766,452 (GRCm39) V1297E probably benign Het
Eif2d C A 1: 131,082,950 (GRCm39) T98K probably damaging Het
Ezh2 T C 6: 47,533,077 (GRCm39) D124G probably damaging Het
Gamt T G 10: 80,094,243 (GRCm39) I223L possibly damaging Het
Gbp7 T C 3: 142,240,402 (GRCm39) V40A probably damaging Het
Gm11992 A G 11: 8,999,165 (GRCm39) E7G probably damaging Het
Gml2 A G 15: 74,692,379 (GRCm39) probably null Het
Grem2 A G 1: 174,664,813 (GRCm39) V12A probably benign Het
Gsta1 T A 9: 78,139,577 (GRCm39) I19N probably damaging Het
Gstt2 T C 10: 75,667,736 (GRCm39) I240V probably benign Het
Hectd4 T C 5: 121,392,291 (GRCm39) L185S possibly damaging Het
Hsd3b7 G A 7: 127,400,419 (GRCm39) probably null Het
Ift22 T A 5: 136,940,638 (GRCm39) M101K probably benign Het
Irs1 A G 1: 82,267,802 (GRCm39) V138A probably benign Het
Ky A G 9: 102,419,141 (GRCm39) M383V possibly damaging Het
Lama4 A G 10: 38,946,005 (GRCm39) E796G probably damaging Het
Lcp2 A G 11: 34,038,061 (GRCm39) Y426C probably damaging Het
Lig3 A G 11: 82,688,601 (GRCm39) D755G probably damaging Het
Lrrc43 T A 5: 123,630,470 (GRCm39) I111N probably damaging Het
Lrrc43 A G 5: 123,639,084 (GRCm39) D371G probably benign Het
Lrrc74b C A 16: 17,376,213 (GRCm39) G146* probably null Het
Lrrfip1 A G 1: 91,047,874 (GRCm39) K479E possibly damaging Het
Lrriq1 C A 10: 103,051,055 (GRCm39) E566* probably null Het
Mlxipl C T 5: 135,161,263 (GRCm39) A394V possibly damaging Het
Myh14 T C 7: 44,281,819 (GRCm39) Y813C probably damaging Het
Nat10 T A 2: 103,555,490 (GRCm39) E943D probably benign Het
Nectin2 T A 7: 19,466,912 (GRCm39) K226* probably null Het
Nlrc5 T G 8: 95,219,720 (GRCm39) S1103R probably benign Het
Nr4a1 T A 15: 101,169,641 (GRCm39) Y304N probably damaging Het
Ntpcr T C 8: 126,474,483 (GRCm39) V184A probably benign Het
Or1j13 T A 2: 36,369,345 (GRCm39) N266Y probably damaging Het
Or5p73 T C 7: 108,064,978 (GRCm39) V149A probably benign Het
Or5t18 A G 2: 86,637,191 (GRCm39) S51P probably benign Het
Oxr1 A C 15: 41,517,030 (GRCm39) S65R possibly damaging Het
Pcdhb19 A T 18: 37,630,720 (GRCm39) I172L probably benign Het
Pds5a A T 5: 65,795,925 (GRCm39) I655N possibly damaging Het
Pik3cg T C 12: 32,250,516 (GRCm39) Y757C probably benign Het
Plekha5 C A 6: 140,472,184 (GRCm39) T37N possibly damaging Het
Ppp4r1 T A 17: 66,118,298 (GRCm39) F167I probably benign Het
Ppp4r1 C T 17: 66,136,394 (GRCm39) A534V probably damaging Het
Ppt2 T A 17: 34,846,300 (GRCm39) probably null Het
Prrt2 A T 7: 126,619,219 (GRCm39) V82D possibly damaging Het
Rassf5 T A 1: 131,108,366 (GRCm39) Y338F probably benign Het
Rbbp6 G A 7: 122,596,251 (GRCm39) V560I possibly damaging Het
Rcbtb1 T C 14: 59,474,127 (GRCm39) M90T unknown Het
Rif1 T A 2: 51,968,399 (GRCm39) L194* probably null Het
Rybp A T 6: 100,209,879 (GRCm39) I128K possibly damaging Het
Samm50 T G 15: 84,098,346 (GRCm39) F462V possibly damaging Het
Slain1 T C 14: 103,923,200 (GRCm39) Y264H probably damaging Het
Slc29a4 C T 5: 142,691,156 (GRCm39) P12L probably benign Het
Slc6a2 T C 8: 93,720,766 (GRCm39) I461T possibly damaging Het
Soat2 A G 15: 102,069,106 (GRCm39) D377G probably damaging Het
Spocd1 A G 4: 129,823,893 (GRCm39) E230G Het
Tbc1d30 T A 10: 121,183,061 (GRCm39) K126* probably null Het
Tgfbi T A 13: 56,779,997 (GRCm39) F515L probably damaging Het
Utf1 A G 7: 139,524,704 (GRCm39) probably benign Het
Vmn1r206 G T 13: 22,804,471 (GRCm39) Y245* probably null Het
Vmn1r87 T A 7: 12,865,832 (GRCm39) S152C probably damaging Het
Zfc3h1 C A 10: 115,256,588 (GRCm39) Y1519* probably null Het
Zfp248 A T 6: 118,407,103 (GRCm39) L162H possibly damaging Het
Zfp804a T A 2: 82,086,917 (GRCm39) F249I probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCAAGGACCCAAATGTG -3'
(R):5'- CCGCACTAAGAGGCATCTTG -3'

Sequencing Primer
(F):5'- AAATGTGCCACCCCTTCC -3'
(R):5'- CTGCTGCAGGTTCCTCTTGG -3'
Posted On 2019-12-20