Incidental Mutation 'R7911:Calcrl'
ID610491
Institutional Source Beutler Lab
Gene Symbol Calcrl
Ensembl Gene ENSMUSG00000059588
Gene Namecalcitonin receptor-like
SynonymsCRLR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7911 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84330626-84425411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84351231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 191 (I191S)
Ref Sequence ENSEMBL: ENSMUSP00000073875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074262] [ENSMUST00000099944]
Predicted Effect probably damaging
Transcript: ENSMUST00000074262
AA Change: I191S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073875
Gene: ENSMUSG00000059588
AA Change: I191S

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 5.7e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099944
AA Change: I191S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097527
Gene: ENSMUSG00000059588
AA Change: I191S

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 3.2e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality between E13.5-E14.5, hydrops fetalis and cardiovascular defects such as thin vascular smooth muscle walls and small, disorganized hearts resulting from a decrease in cell proliferation and an increasein apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Chst15 T C 7: 132,270,522 Q10R probably benign Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
D1Ertd622e T A 1: 97,645,890 H150L probably damaging Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Farp1 T C 14: 121,242,406 S370P probably damaging Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Hsh2d A G 8: 72,196,804 E45G probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Ipo5 A G 14: 120,929,639 probably null Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Prdm15 A G 16: 97,812,592 M459T probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Usp53 T C 3: 122,961,267 M180V probably benign Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in Calcrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Calcrl APN 2 84370454 missense probably benign 0.05
IGL01395:Calcrl APN 2 84368575 missense probably benign 0.25
IGL01672:Calcrl APN 2 84345070 missense probably damaging 1.00
IGL01738:Calcrl APN 2 84370449 missense probably benign 0.00
IGL01773:Calcrl APN 2 84370443 missense probably benign
IGL02007:Calcrl APN 2 84375324 missense probably benign
IGL02254:Calcrl APN 2 84348208 missense probably damaging 1.00
IGL02887:Calcrl APN 2 84339242 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0485:Calcrl UTSW 2 84370091 missense probably benign 0.01
R1579:Calcrl UTSW 2 84333537 missense probably benign 0.00
R1640:Calcrl UTSW 2 84333677 missense probably damaging 0.98
R1694:Calcrl UTSW 2 84339287 missense probably damaging 1.00
R1731:Calcrl UTSW 2 84345168 critical splice donor site probably null
R1779:Calcrl UTSW 2 84351285 missense probably damaging 1.00
R1992:Calcrl UTSW 2 84370511 missense probably damaging 0.98
R2262:Calcrl UTSW 2 84345173 missense probably damaging 1.00
R2763:Calcrl UTSW 2 84370503 missense probably damaging 0.99
R3903:Calcrl UTSW 2 84368642 splice site probably benign
R4838:Calcrl UTSW 2 84351205 missense probably damaging 0.99
R4901:Calcrl UTSW 2 84333513 missense probably benign 0.00
R4997:Calcrl UTSW 2 84351248 nonsense probably null
R4998:Calcrl UTSW 2 84339314 missense probably damaging 1.00
R5791:Calcrl UTSW 2 84351265 missense probably damaging 1.00
R5887:Calcrl UTSW 2 84370497 missense probably damaging 1.00
R6046:Calcrl UTSW 2 84375314 missense probably benign 0.00
R6207:Calcrl UTSW 2 84333530 missense probably benign 0.00
R6959:Calcrl UTSW 2 84370084 missense possibly damaging 0.76
R6972:Calcrl UTSW 2 84368578 missense probably benign
R7522:Calcrl UTSW 2 84373364 missense probably benign
R7653:Calcrl UTSW 2 84345185 nonsense probably null
R8082:Calcrl UTSW 2 84370442 missense possibly damaging 0.56
R8110:Calcrl UTSW 2 84339339 missense probably damaging 1.00
R8152:Calcrl UTSW 2 84339249 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCTATGTTTCCTGTATGTAAACCCC -3'
(R):5'- AAAGCAACTCATTTCCATCTGG -3'

Sequencing Primer
(F):5'- CCTACTAACCCTCAAAGGTA -3'
(R):5'- TTTCCAAAGTTAAAGCAACCTTTATG -3'
Posted On2019-12-20