Incidental Mutation 'R0683:Exoc8'
ID61050
Institutional Source Beutler Lab
Gene Symbol Exoc8
Ensembl Gene ENSMUSG00000074030
Gene Nameexocyst complex component 8
SynonymsSEC84, EXO84, Exo84p
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0683 (G1)
Quality Score163
Status Not validated
Chromosome8
Chromosomal Location124893108-124897705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124895633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 665 (I665T)
Ref Sequence ENSEMBL: ENSMUSP00000095915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably benign
Transcript: ENSMUST00000034467
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098312
AA Change: I665T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030
AA Change: I665T

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213052
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the exocyst complex, an evolutionarily conserved multi-protein complex that plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. This protein is a target of activated Ral subfamily of GTPases and thereby regulates exocytosis by tethering vesicles to the plasma membrane. Mutations in this gene may be related to Joubert syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Gm6768 T C 12: 119,261,078 noncoding transcript Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Maml3 G A 3: 51,856,752 Q264* probably null Het
Neu1 A T 17: 34,934,325 probably null Het
Nrp2 A G 1: 62,744,318 T193A probably benign Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Serpinb13 A G 1: 106,999,021 N249S probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Zfp763 G A 17: 33,018,918 P418S probably damaging Het
Other mutations in Exoc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Exoc8 APN 8 124896872 missense probably damaging 1.00
IGL01444:Exoc8 APN 8 124895841 missense possibly damaging 0.84
IGL01655:Exoc8 APN 8 124896228 missense probably benign 0.03
IGL01881:Exoc8 APN 8 124896351 missense probably damaging 1.00
IGL02952:Exoc8 APN 8 124897536 missense probably benign 0.02
R2051:Exoc8 UTSW 8 124895480 missense probably benign 0.15
R2140:Exoc8 UTSW 8 124897415 missense possibly damaging 0.84
R2197:Exoc8 UTSW 8 124895738 missense probably damaging 1.00
R2209:Exoc8 UTSW 8 124896179 nonsense probably null
R4659:Exoc8 UTSW 8 124897532 missense probably damaging 1.00
R4707:Exoc8 UTSW 8 124897470 missense possibly damaging 0.93
R4724:Exoc8 UTSW 8 124897250 missense probably benign
R4764:Exoc8 UTSW 8 124897575 missense possibly damaging 0.94
R5159:Exoc8 UTSW 8 124896213 missense probably benign 0.00
R5976:Exoc8 UTSW 8 124896653 missense probably benign 0.02
R6566:Exoc8 UTSW 8 124896044 missense probably damaging 1.00
R6602:Exoc8 UTSW 8 124896411 missense probably damaging 1.00
R7246:Exoc8 UTSW 8 124896417 nonsense probably null
R7341:Exoc8 UTSW 8 124896581 missense probably damaging 1.00
R7440:Exoc8 UTSW 8 124895781 missense probably benign
R7745:Exoc8 UTSW 8 124895819 missense probably benign
R7982:Exoc8 UTSW 8 124896410 missense probably damaging 1.00
R8499:Exoc8 UTSW 8 124897110 missense probably benign 0.01
R8504:Exoc8 UTSW 8 124895970 missense probably benign 0.17
Z1176:Exoc8 UTSW 8 124896666 missense possibly damaging 0.52
Z1177:Exoc8 UTSW 8 124897186 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCAGACCACAGAAGTCGTGCTCTC -3'
(R):5'- ATTGGGCTGGACCTCACCTTCATC -3'

Sequencing Primer
(F):5'- TCGGGATTCACCCGCAG -3'
(R):5'- CATGAACCTGATGACTCCTGAGG -3'
Posted On2013-07-30