Incidental Mutation 'R7911:Chst15'
ID 610511
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7911 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132270522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 10 (Q10R)
Ref Sequence ENSEMBL: ENSMUSP00000076682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect probably benign
Transcript: ENSMUST00000077472
AA Change: Q10R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: Q10R

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080215
AA Change: Q10R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: Q10R

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Calcrl A C 2: 84,351,231 I191S probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
D1Ertd622e T A 1: 97,645,890 H150L probably damaging Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Farp1 T C 14: 121,242,406 S370P probably damaging Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Hsh2d A G 8: 72,196,804 E45G probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Ipo5 A G 14: 120,929,639 probably null Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Prdm15 A G 16: 97,812,592 M459T probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Usp53 T C 3: 122,961,267 M180V probably benign Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R8282:Chst15 UTSW 7 132270150 missense probably benign
R8342:Chst15 UTSW 7 132247886 missense probably benign 0.15
R9011:Chst15 UTSW 7 132270517 missense probably benign
R9093:Chst15 UTSW 7 132268917 critical splice donor site probably null
R9329:Chst15 UTSW 7 132266791 missense possibly damaging 0.46
R9352:Chst15 UTSW 7 132270528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCAGGCTACATCGCTTC -3'
(R):5'- CCAAAGACTGTGCCTCATTCTC -3'

Sequencing Primer
(F):5'- AAACCCACCCCAGTTTTCATTG -3'
(R):5'- AAAGACTGTGCCTCATTCTCTAGTG -3'
Posted On 2019-12-20