Incidental Mutation 'R7911:Hsh2d'
ID610514
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7911 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72196804 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000071970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000165324]
Predicted Effect probably damaging
Transcript: ENSMUST00000072097
AA Change: E45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: E45G

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165324
AA Change: E45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: E45G

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Meta Mutation Damage Score 0.7267 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Calcrl A C 2: 84,351,231 I191S probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Chst15 T C 7: 132,270,522 Q10R probably benign Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
D1Ertd622e T A 1: 97,645,890 H150L probably damaging Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Farp1 T C 14: 121,242,406 S370P probably damaging Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Ipo5 A G 14: 120,929,639 probably null Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Prdm15 A G 16: 97,812,592 M459T probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Usp53 T C 3: 122,961,267 M180V probably benign Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
R7673:Hsh2d UTSW 8 72200511 missense probably benign 0.15
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTGCTCAGAGGTAAGAGG -3'
(R):5'- AATCTCAGGTCCACCCAAGTG -3'

Sequencing Primer
(F):5'- CATTGCTCAGAGGTAAGAGGGTACAC -3'
(R):5'- CCAAGTGTTCCAGCTAGGTCTG -3'
Posted On2019-12-20